ID: 981549448

View in Genome Browser
Species Human (GRCh38)
Location 4:145928639-145928661
Sequence GCAGTAACTCGCTTGTGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981549445_981549448 12 Left 981549445 4:145928604-145928626 CCCACTTCACAAATGAGAAAAAC 0: 1
1: 3
2: 24
3: 259
4: 1827
Right 981549448 4:145928639-145928661 GCAGTAACTCGCTTGTGTCACGG 0: 1
1: 0
2: 0
3: 3
4: 52
981549444_981549448 25 Left 981549444 4:145928591-145928613 CCTACAATGGTCTCCCACTTCAC 0: 1
1: 0
2: 3
3: 17
4: 182
Right 981549448 4:145928639-145928661 GCAGTAACTCGCTTGTGTCACGG 0: 1
1: 0
2: 0
3: 3
4: 52
981549446_981549448 11 Left 981549446 4:145928605-145928627 CCACTTCACAAATGAGAAAAACA 0: 1
1: 2
2: 21
3: 202
4: 1535
Right 981549448 4:145928639-145928661 GCAGTAACTCGCTTGTGTCACGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981549448 Original CRISPR GCAGTAACTCGCTTGTGTCA CGG Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
908150654 1:61298101-61298123 GCTGTAATTCCCATGTGTCAAGG + Intronic
910300378 1:85700213-85700235 GCAGTAACTGGCATGTGGGAAGG - Intronic
912398568 1:109368728-109368750 GCAGTACCTCCTTTGTGGCAGGG + Intronic
916550098 1:165841802-165841824 GCAGTCATTCTCTTGTGTCATGG + Intronic
1063088144 10:2837628-2837650 CCCGGAACTCGTTTGTGTCAGGG - Intergenic
1063567781 10:7186536-7186558 GCAGCAAATCGCTTGAGTCCAGG - Intronic
1069807536 10:71135322-71135344 CCTGTAACTTGCTTTTGTCAAGG - Intergenic
1072861833 10:99014121-99014143 GCAGGGACTCGCGTGTGGCAGGG - Intronic
1075268239 10:121025108-121025130 GCAGTGACTGGCCTATGTCAAGG - Intergenic
1085551551 11:77378032-77378054 CCAGTATCTGGCTTGTTTCAAGG - Intronic
1087199641 11:95332686-95332708 GCAGCAACTCCCTGGTGTCTTGG + Intergenic
1091083896 11:132701325-132701347 GCAATAAGTCCCATGTGTCAAGG - Intronic
1091133661 11:133168223-133168245 GGAGTATCTCCCTGGTGTCATGG - Intronic
1096745036 12:53721325-53721347 CCAGTAACTAGCTTGAGTGAGGG + Intronic
1098662367 12:73112069-73112091 GCAGTAACTCCCTTCTCCCAGGG + Intergenic
1101231815 12:102749032-102749054 GTAATAACTCCCATGTGTCAAGG - Intergenic
1107840385 13:44451240-44451262 GCAGTGTCCCGCTTCTGTCACGG - Intronic
1111304435 13:86388838-86388860 GCATTAACTTGACTGTGTCAAGG + Intergenic
1112904594 13:104401224-104401246 GCAATAATTCCCATGTGTCAAGG + Intergenic
1113650655 13:112032033-112032055 GCAGTAGGTTGCTGGTGTCAAGG - Intergenic
1132689365 16:1175650-1175672 GGAGTAACTAGTGTGTGTCAGGG - Intronic
1134294867 16:12936667-12936689 GAAGTAACTGGCTTGTGTTTAGG - Intronic
1134440812 16:14298709-14298731 GCCGCCACTCGCTTGAGTCACGG + Intergenic
1137340322 16:47596032-47596054 ACAGTAATTCCCATGTGTCAAGG + Intronic
1163295087 19:16406568-16406590 GCAGCAACTCCCTGGTGTCCTGG + Intronic
1165589537 19:36955621-36955643 GCAGTAACTCATGTGTGTCCAGG - Intronic
928192790 2:29188713-29188735 TCAGTAACTTGCTTGAGTCAGGG + Intronic
928839410 2:35587210-35587232 GCAGTAAGCTGCTTGGGTCAAGG + Intergenic
944222383 2:197315523-197315545 GCAGTCACTTGATTGTCTCATGG - Intergenic
948545073 2:238722518-238722540 GCAGTAACCCGCTTGGATCCAGG - Intergenic
1174160831 20:48549268-48549290 GCAGTAACTCTCAGGTGTTATGG + Intergenic
1174828909 20:53794952-53794974 GCAGTGATTCTCCTGTGTCATGG - Intergenic
950364295 3:12472063-12472085 GCAGGATCTGGCTTGTGTTAAGG - Intergenic
957246447 3:77722540-77722562 GCAGAAACTGGCTTTTGTCAAGG - Intergenic
957357735 3:79113934-79113956 GCAATAATCCGCATGTGTCAAGG + Intronic
965067202 3:163865025-163865047 CCATTTACTCTCTTGTGTCATGG + Intergenic
969637355 4:8377026-8377048 GCCGTCACCCGCTTGTTTCATGG - Intronic
972995269 4:44871039-44871061 GTAGTAACTGGGTTGAGTCAGGG + Intergenic
973277598 4:48326548-48326570 GCAGAAACTCCTTTCTGTCAGGG + Intergenic
978213302 4:106163771-106163793 GTAGTAATTCCCATGTGTCAAGG - Intronic
980179695 4:129388865-129388887 GTAATAATTCCCTTGTGTCAAGG + Intergenic
981549448 4:145928639-145928661 GCAGTAACTCGCTTGTGTCACGG + Intronic
986507261 5:8464994-8465016 CCAGTAACTCCCATGTGTCCAGG + Intergenic
992906887 5:81355850-81355872 GCAGGAACTCACTTCTCTCAAGG - Intronic
996737496 5:126771514-126771536 GCAGTAACCCACTTTTGTCTTGG - Intergenic
1004080791 6:12390665-12390687 GCAGTATCTCAGTTGTGTCCTGG - Intergenic
1008308440 6:49934586-49934608 GCTGTTCCTCGCTAGTGTCATGG - Intergenic
1018516718 6:164588561-164588583 GCCTTAACTCGCCTGTGTGAGGG - Intergenic
1026616547 7:71910119-71910141 GTAGTAATTCCCATGTGTCAAGG - Intronic
1030742016 7:113120890-113120912 GCAGTGACTGGTGTGTGTCAGGG + Intergenic
1033042053 7:137927813-137927835 ACAGTAAGTCTCTTGTTTCAAGG - Intronic
1037089349 8:14894826-14894848 GAAGTAACTTGCTTGTGTTTGGG - Intronic
1194525120 X:94968485-94968507 GCAGTAATCCCCATGTGTCAAGG + Intergenic
1196595765 X:117543704-117543726 GCAGTACGTGGTTTGTGTCAAGG - Intergenic
1198946678 X:142023882-142023904 GCAATAATTCCCATGTGTCAAGG - Intergenic