ID: 981550001

View in Genome Browser
Species Human (GRCh38)
Location 4:145934501-145934523
Sequence CTAACTGAACAGAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981549993_981550001 20 Left 981549993 4:145934458-145934480 CCATCTCCAAAGCTAATTCGGTT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 156
981549994_981550001 14 Left 981549994 4:145934464-145934486 CCAAAGCTAATTCGGTTCTGAAC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 156
981549992_981550001 21 Left 981549992 4:145934457-145934479 CCCATCTCCAAAGCTAATTCGGT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981550001 Original CRISPR CTAACTGAACAGAAGGAGCT GGG Intronic
903613049 1:24630979-24631001 GGAACTGAACAGAAGTAGATAGG - Intergenic
904419160 1:30380278-30380300 CCATCTGAACTGCAGGAGCTGGG + Intergenic
905120581 1:35678761-35678783 CTAGCCGAACAGTAGGAGCAAGG - Intergenic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
908866163 1:68550870-68550892 AGAGCTGAACTGAAGGAGCTAGG + Intergenic
909358843 1:74739496-74739518 TTAAAGGAACAGAAAGAGCTAGG + Intronic
913579541 1:120212579-120212601 CTAACTCCACAGAATGACCTTGG + Intergenic
913628632 1:120685809-120685831 CTAACTCCACAGAATGACCTTGG - Intergenic
914561475 1:148824006-148824028 CTAACTCCACAGAATGACCTTGG + Intronic
914611360 1:149306202-149306224 CTAACTCCACAGAATGACCTTGG - Intergenic
916018059 1:160768010-160768032 CTAACTGACCAGGAGGAGACAGG - Intergenic
916234813 1:162576079-162576101 CCAACTCAACAGAATGCGCTTGG - Intronic
1065598406 10:27341441-27341463 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1066603101 10:37129683-37129705 CTATTTGAATAGAAAGAGCTTGG - Intronic
1067721636 10:48731936-48731958 CAAAGTGAACAGAGTGAGCTAGG - Intronic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1078226841 11:9399872-9399894 AGACCTGAACAGAAGGAGTTAGG - Intronic
1078683327 11:13501531-13501553 CTGACAGATCAAAAGGAGCTTGG - Intergenic
1078925740 11:15873206-15873228 CTAACTGAACAGACTGTCCTGGG + Intergenic
1078928877 11:15898131-15898153 CTAAGGGAACAGAAGAATCTTGG + Intergenic
1079880844 11:25924172-25924194 CTCACTTATAAGAAGGAGCTAGG - Intergenic
1083768842 11:64855197-64855219 CTCCCTGAACGGAAGCAGCTGGG - Intronic
1083912321 11:65717426-65717448 CTCACTGGACACAAGGAGCGAGG - Intronic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1085207989 11:74748626-74748648 CTTACTGAACTGAAAGAGGTGGG - Intergenic
1087992645 11:104764790-104764812 GTATCTAAACAGAAGGTGCTGGG + Intergenic
1088400072 11:109413856-109413878 CTACCTGAGGAAAAGGAGCTGGG - Intergenic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1090884840 11:130866719-130866741 CTTACTGAACAGAAAGACCTTGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1094496981 12:30994726-30994748 CTAAGTGCACAGCAGGACCTTGG - Exonic
1095830362 12:46579225-46579247 CTAACACAACAGAAGCAGGTGGG - Intergenic
1096317441 12:50580634-50580656 ACAACTGAACTGAAGGAACTGGG - Intronic
1096690148 12:53315518-53315540 CTTACTGGGCAGAAGGACCTGGG - Intronic
1098558846 12:71850389-71850411 CAACCTGCTCAGAAGGAGCTGGG - Intronic
1100742591 12:97610108-97610130 TGAAATGAACAGAAGAAGCTGGG + Intergenic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1105224143 13:18412917-18412939 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1105804297 13:23941928-23941950 CTATCTGAATAGAACGAGCTCGG + Intergenic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110602469 13:77390597-77390619 ATGACTGGAAAGAAGGAGCTTGG - Intergenic
1112711901 13:102138712-102138734 CCTCCTGAACAGAAGGAGCTGGG + Intronic
1114008288 14:18337756-18337778 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1114811573 14:25906532-25906554 CTGACTGACCAGAAGGAACCAGG + Intergenic
1121965923 14:98305715-98305737 ATTACTAAAAAGAAGGAGCTGGG + Intergenic
1122243201 14:100382724-100382746 CTAGCTGAACAGAAAGCTCTTGG + Intronic
1123391484 15:19878344-19878366 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126852685 15:52806510-52806532 ATAGCCCAACAGAAGGAGCTGGG - Intergenic
1127468574 15:59269391-59269413 TTAATTGATTAGAAGGAGCTGGG - Intronic
1129658366 15:77539606-77539628 CCAAGAGAGCAGAAGGAGCTGGG + Intergenic
1130060606 15:80567214-80567236 CTCACTGACCTGAAGGAGCCAGG + Intronic
1130915727 15:88303132-88303154 CTGAGAGAACAGAAGGGGCTTGG - Intergenic
1131062300 15:89411467-89411489 TGAACTGAACAGATGGAGCGTGG - Intergenic
1135835681 16:25823098-25823120 CTAAGTGTAAAGAAGAAGCTGGG - Intronic
1136359652 16:29770585-29770607 CTATTTGAAGAGGAGGAGCTGGG + Intergenic
1137290906 16:47051314-47051336 CTAGCAGGGCAGAAGGAGCTGGG - Intergenic
1137375601 16:47949388-47949410 CTCACTGCACAGAAGAAGTTGGG - Intergenic
1137548605 16:49421363-49421385 CTAATTGATGAGAAGGAGCGAGG + Intergenic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1140102871 16:71933518-71933540 TAAACTGAACAGAAGGAGAAAGG + Exonic
1141690835 16:85595350-85595372 CAAACTGAAAAGGAGAAGCTGGG - Intergenic
1141709007 16:85687335-85687357 ATAACGGAACAGAGGGAGCACGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1145045724 17:19614126-19614148 CTTACTGCACACAAGAAGCTGGG - Intergenic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1148216996 17:45838765-45838787 CTCAGTGAACTGAAGGGGCTTGG + Intergenic
1153975639 18:10266446-10266468 CTGCCTGAAAAGAAGGGGCTGGG - Intergenic
1154529163 18:15326195-15326217 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1157058368 18:44257005-44257027 CCAACTGAACAGATGGAAATAGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158278689 18:55796745-55796767 CTACCTCAACAGAACTAGCTTGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
926261197 2:11263939-11263961 CTAACTCAATATAAGGAGGTGGG + Intronic
926384960 2:12326964-12326986 CTAACTCCACTGAATGAGCTTGG + Intergenic
926919274 2:17924850-17924872 CTAGCTTCATAGAAGGAGCTGGG + Intronic
927730259 2:25464894-25464916 CTCACAGAACAGAAGGAGCCAGG + Intronic
928289171 2:30022580-30022602 CTAACTGAAAAATAGGAGATGGG - Intergenic
932969511 2:76523160-76523182 CAACCTGAACAGAAGCATCTTGG - Intergenic
938528265 2:132157610-132157632 CTGTTTGAACAGAAAGAGCTTGG + Intronic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
944128298 2:196318689-196318711 GTACCTGACCAGGAGGAGCTGGG - Exonic
944311986 2:198243807-198243829 CTCACTGAATAAAAGGAGTTAGG - Intronic
945182217 2:207103385-207103407 CCAACAGAACAAAAGGAGTTTGG + Intronic
1168872064 20:1138129-1138151 CTAGCTTCACAGAAGAAGCTGGG - Intronic
1169281646 20:4272706-4272728 CTAACCAAAAAGGAGGAGCTGGG - Intergenic
1172055765 20:32153193-32153215 TTAACTGCACATAAGGACCTTGG + Intronic
1173789376 20:45817696-45817718 CTAACAGACCTGAAGGAGTTGGG - Intergenic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174076878 20:47943657-47943679 AGAAATGAACAGAAGGAGGTTGG - Intergenic
1174322516 20:49753133-49753155 CTGTCAGAACAGAAAGAGCTTGG + Intergenic
1175666467 20:60864287-60864309 CCAAATGAAAAGCAGGAGCTTGG + Intergenic
1176768235 21:13042292-13042314 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1178668310 21:34567981-34568003 CTAAGCGCACAGAAGGGGCTCGG + Intronic
1180432793 22:15268573-15268595 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1180515366 22:16136519-16136541 CTATTTGAATAGAAAGAGCTTGG - Intergenic
1182518592 22:30872674-30872696 CTGATTCAACAGCAGGAGCTTGG - Intronic
1182754184 22:32665336-32665358 CTCACTCATCAGTAGGAGCTAGG - Intronic
951116949 3:18874841-18874863 TTATCTGAACAGAAGGAACAAGG - Intergenic
952347503 3:32502517-32502539 CAAGCTGAAACGAAGGAGCTCGG + Intronic
953915816 3:46920607-46920629 CCAACTGGACAGACGGAGCCTGG + Intergenic
957807448 3:85168214-85168236 CTAACAGCACAAAATGAGCTAGG - Intronic
959130137 3:102344753-102344775 CTAAATGACAAGAAGGAGCCTGG + Intronic
960530671 3:118760711-118760733 CTAACTGGGGAGAAGGAGCAGGG - Intergenic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
966965731 3:184990539-184990561 CTAACTGTGCAGATTGAGCTGGG + Intronic
967853116 3:194096993-194097015 CTAACTGAGCAAACTGAGCTTGG - Intergenic
968352969 3:198077464-198077486 CTATTTGGACAGAATGAGCTTGG + Intergenic
972239884 4:37178864-37178886 CTGAGTGAACAGAGGTAGCTGGG - Intergenic
975774979 4:77776655-77776677 CTAAATGAAGGGAAGGAGTTAGG - Intronic
978074678 4:104513861-104513883 CTAAGAGAACAGAAGGAAATAGG - Intergenic
978667772 4:111206799-111206821 CTGATATAACAGAAGGAGCTTGG - Intergenic
980658928 4:135830788-135830810 ATAACTGAAAAGAATGAGGTGGG + Intergenic
980667609 4:135959642-135959664 CTAAATGAACAGGAGGATTTGGG - Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
983228832 4:165109999-165110021 CTAACTACACTGAAGGAGTTGGG + Intronic
983463620 4:168058087-168058109 CTAACAGACCAAAAGGAGGTAGG - Intergenic
986404096 5:7408163-7408185 AGAACTGAACAGAAGGGGCCAGG - Intronic
986569061 5:9146630-9146652 GGAACTGAACCGAAGGACCTTGG - Intronic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
988289302 5:29265284-29265306 ACACCTGAACAGAAGTAGCTTGG - Intergenic
990757899 5:59096118-59096140 ATAGCTGAAAAGGAGGAGCTGGG + Intronic
990967980 5:61470349-61470371 CTAAATGTACAGAATGTGCTTGG + Intronic
992207559 5:74445715-74445737 CTGACTGAACAGCAGGTCCTGGG + Intergenic
992399320 5:76397229-76397251 GTAACTGAGCATTAGGAGCTGGG + Intergenic
996362100 5:122660399-122660421 TTGACTGAACACATGGAGCTGGG + Intergenic
998481752 5:142468771-142468793 CTAACTGAACAAAAAGAACCTGG - Intergenic
999111438 5:149124976-149124998 CTGATTGAACAGAGTGAGCTGGG + Intergenic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1002400599 5:178989724-178989746 CTAACAGGAAAGAAGGAGCAGGG - Intronic
1002995676 6:2282349-2282371 CTTACTGATCAGTAGTAGCTTGG + Intergenic
1003128304 6:3373592-3373614 CTAAATCAAAAGAAGAAGCTGGG + Intronic
1012233102 6:96783332-96783354 CTAATTGCAAAGAAGAAGCTAGG + Intergenic
1012313412 6:97756137-97756159 AGAACAGAACAGAAGGATCTGGG - Intergenic
1012756920 6:103243318-103243340 ATAAATGAAGAGAAAGAGCTAGG + Intergenic
1014235969 6:118955134-118955156 GTATCTGAACAGAAGGTGCTTGG - Intergenic
1017890001 6:158630060-158630082 CAAACTGAACAGCAAAAGCTGGG - Intronic
1017963273 6:159240679-159240701 CTCCCTGAAGAGCAGGAGCTAGG + Intronic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1035090393 7:156305507-156305529 ATAAATGAACACAAGGAGCCAGG + Intergenic
1037506830 8:19538937-19538959 CTAACAGAAGAGAAGGAGCCAGG - Intronic
1037692531 8:21194311-21194333 CTAACAGAACAGACTGAACTAGG + Intergenic
1038517258 8:28197558-28197580 CTAGTTGAACAGACTGAGCTGGG - Intergenic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041384403 8:57283954-57283976 CTATTTGGACAGAAAGAGCTTGG - Intergenic
1041536074 8:58926770-58926792 CTAACTGAAGACCAGGAGTTGGG - Intronic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1045664353 8:104469100-104469122 CTAACTGAACACTAGTCGCTGGG + Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1045910312 8:107399822-107399844 CTCACTGAACTGAAGGAGCCAGG + Intronic
1046748220 8:117898406-117898428 CTCAGTGGACAGAAGGAGCTAGG + Intronic
1048754295 8:137718932-137718954 CTTACTTATCAGCAGGAGCTAGG + Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050454672 9:5822328-5822350 CTAACTAATGAGAAGAAGCTGGG - Intronic
1051035500 9:12740212-12740234 CTAAAAGAACAGAAAGAACTTGG + Intergenic
1053706880 9:40763940-40763962 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1054416794 9:64884706-64884728 CTATTTGAATAGAAAGAGCTTGG + Intergenic
1055865000 9:80802413-80802435 CTCACTGAACAGATGGAGGCAGG + Intergenic
1057153186 9:92813390-92813412 CTATTTGGACAGAATGAGCTTGG - Intergenic
1061518506 9:131103491-131103513 CTAATTGCACAGAAGGAGCCTGG - Intronic
1186787543 X:12967847-12967869 CTAACTGCACAGCAGGGGGTTGG - Intergenic
1188813403 X:34681230-34681252 CAAACTGAACTGAATGAGATGGG + Intergenic
1189463031 X:41257886-41257908 CTAAAGGAACAGAAGGTACTGGG - Intergenic
1190710078 X:53061326-53061348 TTAACTGCACAGAAGCAGCTAGG - Intronic
1193823869 X:86198423-86198445 AGAGCTGAACAGAAGGAGATTGG + Intronic
1195918982 X:109963752-109963774 CCATCTGAACAGAAGGAGCAGGG - Intergenic
1196217136 X:113066766-113066788 TTAAATGATCATAAGGAGCTGGG + Intergenic
1196457200 X:115898993-115899015 CTCAGTGAAGAGAAGGAGATTGG + Intergenic