ID: 981550181

View in Genome Browser
Species Human (GRCh38)
Location 4:145936111-145936133
Sequence CTGCCGTGCTTGGACAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981550181_981550184 -2 Left 981550181 4:145936111-145936133 CCCATTTTGTCCAAGCACGGCAG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 981550184 4:145936132-145936154 AGACCTCCCCTGACCCCCTCAGG 0: 1
1: 1
2: 3
3: 24
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981550181 Original CRISPR CTGCCGTGCTTGGACAAAAT GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
905477743 1:38240752-38240774 CTGCCATGAATGCACAAAATGGG - Intergenic
908020218 1:59891062-59891084 AGGAAGTGCTTGGACAAAATGGG + Intergenic
909895784 1:81067118-81067140 TTGCCGTGGTTGCAAAAAATTGG + Intergenic
910678639 1:89840667-89840689 GTACAGTACTTGGACAAAATAGG + Intronic
913350906 1:117857948-117857970 TTATCGTGCTTGGAAAAAATAGG + Intergenic
915490940 1:156249772-156249794 CTGCTGTGCTGGGACAGAATGGG - Exonic
921786129 1:219231754-219231776 CTGCCATGCTTTGACAAGCTCGG + Intergenic
923027615 1:230218469-230218491 CTGCCGTGTGAGGACTAAATGGG + Intronic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
1064358192 10:14638901-14638923 CCACCGTGCCTGGACAAAGTAGG - Intronic
1064525053 10:16246432-16246454 CAACCGTGCCTGGCCAAAATAGG + Intergenic
1065925485 10:30431596-30431618 CTGCCGTGTTTAGACAACAAAGG - Intergenic
1070337679 10:75469743-75469765 CTGCCGTGCTTGGAAGAACCTGG + Intronic
1070767629 10:79065910-79065932 CTGCCATGCTTGCACAGAAGGGG + Intergenic
1074334971 10:112563044-112563066 CAGCCGTACTAGCACAAAATGGG + Intronic
1082061230 11:47861923-47861945 CTGCTGTGCTGGGACAAGAATGG - Intergenic
1086109478 11:83183775-83183797 CCACCGTGCTCGGCCAAAATAGG + Intronic
1088411608 11:109540237-109540259 CTGCAGTGATTGGAGCAAATTGG - Intergenic
1088678907 11:112222358-112222380 CTGCTGTGCTGGGACAGAATGGG - Intronic
1090463865 11:126915566-126915588 CTGTCTCGCTTGGACAAAACTGG - Intronic
1092869267 12:12791842-12791864 CTGCCTTGCATGGTCAAGATCGG - Intronic
1109059548 13:57597145-57597167 CTGCTGTGCTATTACAAAATAGG - Intergenic
1116510086 14:45734333-45734355 TTTCTGTGTTTGGACAAAATAGG + Intergenic
1116625703 14:47260161-47260183 CTGACCTGCCTGGAGAAAATGGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1130135948 15:81182078-81182100 CTGCCATGCCGGGACAAAAAAGG - Intronic
1139498729 16:67342747-67342769 GTGCAGAGCTTGGGCAAAATGGG - Intronic
1141862979 16:86730559-86730581 CTGCTGAGCTTGTACAAAAAAGG + Intergenic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143421164 17:6793595-6793617 CCACCGTGCCTGGACAAATTTGG + Intronic
1143456726 17:7072675-7072697 CTGCAGTGCTTGGCCACAAAAGG - Intergenic
1144287772 17:13795076-13795098 CTGCTGTTGTTGGACAAAACTGG - Intergenic
1152626427 17:81389885-81389907 CTGACCTGGTTGGACAAAACCGG + Intergenic
1154165967 18:12014727-12014749 CAGCAGTGCCTGGGCAAAATCGG - Intronic
1155870940 18:31027284-31027306 CAGACGTGCTTGAACAAGATTGG + Intronic
1163149741 19:15403922-15403944 CTGCCCTGCTTGGCCAAGGTTGG - Intronic
927522805 2:23710659-23710681 CAACCGTGCATGGAAAAAATTGG + Intergenic
930183694 2:48389717-48389739 CTGCCATGTTTCCACAAAATAGG - Intergenic
931159283 2:59670699-59670721 CTGCCTTTCTTTTACAAAATGGG + Intergenic
943100722 2:183482705-183482727 CAGCTATACTTGGACAAAATAGG - Intergenic
943764751 2:191648568-191648590 CTACTGTGCTTGGCCAAAGTTGG + Intergenic
945665260 2:212733630-212733652 CTGCTGTGCTTGCAGAAATTTGG + Intergenic
1182578288 22:31288544-31288566 TTGCCATTCTTGGGCAAAATCGG - Intronic
954711416 3:52506803-52506825 CTGCAGTGCTTGGGCAGGATGGG - Exonic
954909132 3:54088174-54088196 CTGTCGTGCTTGGGAAGAATGGG - Intergenic
961090599 3:124107888-124107910 CTTCTGTGTTTGGACAGAATGGG + Intronic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
969942949 4:10753258-10753280 CTGCCCTGGATGGACAAATTGGG + Intergenic
971926599 4:33017757-33017779 CTGCACAGTTTGGACAAAATGGG + Intergenic
978387812 4:108193161-108193183 CTTCAGTGCTTAGAGAAAATTGG + Intergenic
978671866 4:111257630-111257652 CTGCCTTTCTTGGACAAATCAGG + Intergenic
981550181 4:145936111-145936133 CTGCCGTGCTTGGACAAAATGGG - Intronic
984757718 4:183339528-183339550 CTGCTGTGCTTGGAGAACAGAGG - Intergenic
990976272 5:61564463-61564485 CTGCTTTGCTGGGACAAAAGTGG + Intergenic
992776500 5:80093764-80093786 CTGCGGTGCATGGACAACACAGG - Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
999398914 5:151249516-151249538 CTGCCCAGCCTGGAAAAAATGGG - Intronic
1003932229 6:10935830-10935852 CTGCAGTTGTTGCACAAAATTGG + Intronic
1013639798 6:112062359-112062381 CTGCCTAGCTTGGGAAAAATGGG - Intronic
1020522224 7:9205802-9205824 CTACCATTCTTGGACAAAGTGGG + Intergenic
1042384635 8:68159499-68159521 CTGCAGTACTTGTAAAAAATGGG + Intronic
1050210777 9:3253524-3253546 CTGCCTTTCTTGGGCAGAATTGG - Intronic
1052750049 9:32481063-32481085 CTGACATGGTTGGAAAAAATTGG - Intronic
1055377203 9:75661855-75661877 CTTCCTTTCTTGTACAAAATGGG + Intergenic
1055689497 9:78814195-78814217 TTGCAGTGGTTGTACAAAATTGG + Intergenic
1057847719 9:98538463-98538485 CAGCCATGCTTGGCCAAAGTGGG + Intronic
1186365299 X:8886317-8886339 ATGCCCTGGTTGGACAAAATGGG - Intergenic
1190438825 X:50455897-50455919 GTGCCTTGCTTTGACAAAATTGG - Intronic
1201265723 Y:12204730-12204752 CTGCCATGCCTGGATAAAATTGG - Intergenic