ID: 981550492

View in Genome Browser
Species Human (GRCh38)
Location 4:145937380-145937402
Sequence CAGTCGGAGCAGACGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981550492_981550496 -4 Left 981550492 4:145937380-145937402 CCCGGCTCCGTCTGCTCCGACTG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 981550496 4:145937399-145937421 ACTGACCCCGCATTTTATTGCGG No data
981550492_981550498 1 Left 981550492 4:145937380-145937402 CCCGGCTCCGTCTGCTCCGACTG 0: 1
1: 0
2: 1
3: 10
4: 139
Right 981550498 4:145937404-145937426 CCCCGCATTTTATTGCGGCCAGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981550492 Original CRISPR CAGTCGGAGCAGACGGAGCC GGG (reversed) Intronic
900428969 1:2593089-2593111 CAGTCTGAGTAGGCTGAGCCTGG + Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901438575 1:9264069-9264091 CAGCCGGAGCAGCTGGTGCCAGG + Exonic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
903016183 1:20363622-20363644 CAGTAGGAGCAGCTGGAACCTGG - Intergenic
904028876 1:27521617-27521639 CAGTCAGGGCTGCCGGAGCCGGG + Intergenic
905910362 1:41649311-41649333 CAGTGGGAGAAGGTGGAGCCTGG - Intronic
905995865 1:42380500-42380522 CAGCCGGAGCAGGAGGGGCCGGG - Intergenic
906950158 1:50328515-50328537 CAGACAGAGCAGAAGCAGCCTGG + Intergenic
908280604 1:62530883-62530905 CAGTGGGAGAAGGAGGAGCCAGG - Intronic
917163619 1:172086301-172086323 CAGTCTGATTGGACGGAGCCTGG + Intronic
917202534 1:172532929-172532951 CAGGCGGAGAAGCCGGAGGCAGG - Intronic
918482447 1:184993126-184993148 CAATTGGAGCAAAAGGAGCCAGG + Intergenic
920864848 1:209743444-209743466 CAGTCAGAGCAGAAGGACACAGG + Intergenic
1064031257 10:11884897-11884919 CAGTCAGAGAAGACAGGGCCCGG + Intergenic
1066370472 10:34815037-34815059 CAGCCGGAGCAGCCGAGGCCGGG + Exonic
1066438436 10:35415157-35415179 CACTCAGAGGAGATGGAGCCTGG + Intronic
1067111971 10:43407555-43407577 CAGCCGGCGCAGCAGGAGCCGGG + Intronic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1075581937 10:123625479-123625501 CAGTTGGAGCAGAAAGTGCCAGG + Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076881012 10:133239274-133239296 CTGGCTGAGGAGACGGAGCCCGG + Intronic
1077172958 11:1176532-1176554 CCGTCGGGGCACACGCAGCCAGG - Intronic
1079126249 11:17720386-17720408 CCGTCGGAGCAGTTGGAGCGCGG - Exonic
1082106553 11:48227744-48227766 CAGTGGGAGCAGAAAGATCCAGG - Intergenic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083190698 11:61050026-61050048 GAGCTGGAGCAGAGGGAGCCAGG - Intergenic
1083252918 11:61479962-61479984 CAGTGGGTGGAGACGGAGCCTGG - Intronic
1089789047 11:120929371-120929393 CAATGGGATCAGAAGGAGCCAGG - Intronic
1091176519 11:133563280-133563302 CAGTCAGAGAAGACGGTGCAAGG - Intergenic
1098482193 12:70976762-70976784 CAGTTGGAGTAGACAGTGCCTGG + Intergenic
1099001880 12:77187852-77187874 CAATGGGAGCAGAGGAAGCCTGG - Intergenic
1103343615 12:120234881-120234903 CAGGGGGAGGAGTCGGAGCCAGG + Intronic
1103971187 12:124673932-124673954 CAGTGGGAGCAGAAGGATCTGGG - Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1112323884 13:98430588-98430610 CTGTCTGAGCAGACGGGGCGAGG + Intronic
1114055509 14:18964631-18964653 CACTGGGACCAGATGGAGCCAGG + Intergenic
1114107036 14:19437132-19437154 CACTGGGACCAGATGGAGCCAGG - Intergenic
1121236752 14:92397278-92397300 AAGCCGGAGCAGAAGGAGCTGGG - Intronic
1124695070 15:31857588-31857610 CAGTCAGCGCAGCCTGAGCCGGG + Intronic
1125003649 15:34795600-34795622 CAGTTGGAGCAGCCGGGGGCAGG + Exonic
1131277473 15:90994270-90994292 CAGTCGGCGCCGAGGGAGGCCGG - Intronic
1135116158 16:19725004-19725026 GAGGCAGAGCAGAAGGAGCCCGG - Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1136398820 16:30006929-30006951 CAGTTGGAGCAGGCGGAGCAGGG - Exonic
1140432260 16:74914181-74914203 CAGTCTGAGCGGACAGAGCAAGG + Intronic
1142054684 16:87985741-87985763 CAGTCCCTGCAGACGGACCCAGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1143638859 17:8183845-8183867 GAGGAGGAGGAGACGGAGCCGGG - Intergenic
1147725555 17:42564331-42564353 GAGTCGGAGGAGGAGGAGCCTGG + Intronic
1148887872 17:50786677-50786699 CAGCGGGAGCAGAGGGAGCTGGG + Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1151317451 17:73332004-73332026 CAGTAGGAGCAGACGTATGCTGG - Intergenic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1157515356 18:48307238-48307260 GAGTCGTAGAACACGGAGCCTGG - Intronic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1161264824 19:3359424-3359446 CAGCCGGAGCCGCCGCAGCCGGG + Intergenic
1161317847 19:3626603-3626625 CAGACGGAGGCGGCGGAGCCGGG - Exonic
1161451116 19:4345932-4345954 CAGCTGGTGCAGCCGGAGCCAGG - Exonic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1162350538 19:10146319-10146341 CCCTCGGAGCAGCCGGGGCCAGG - Intronic
1163632457 19:18424418-18424440 CAGATGGAGGAGACGGAGCAGGG + Intronic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1166389712 19:42402184-42402206 CAGACGGAGTGGACGGAGGCAGG + Intronic
1166520724 19:43478539-43478561 CAGCCAGAGCTGACAGAGCCAGG + Intronic
1166521101 19:43480792-43480814 CAGCCAGAGCTGACAGAGCCAGG + Intronic
1167451738 19:49574528-49574550 CAGCTGGAGCAGACTGAGACAGG - Intronic
1168239846 19:55083578-55083600 CAGTCGGGTCAGGCGGGGCCAGG - Intronic
1168293733 19:55369275-55369297 CCGTCGGAGCAGACGCGGCCCGG + Intronic
925151549 2:1618705-1618727 CAGTGGGAACAGACTGAACCAGG - Intergenic
927277408 2:21273616-21273638 CTGTCAGAGCAGACGCAGCCAGG - Intergenic
927637967 2:24829715-24829737 CAATTGGAGCACACGGTGCCGGG - Intronic
938473671 2:131589208-131589230 CACTGGGACCAGACGGAGCCAGG + Intergenic
938902051 2:135806873-135806895 CAGATGGAGCAGGGGGAGCCTGG - Intronic
939972555 2:148678662-148678684 CACTCGGAGCAGCCGGCCCCAGG - Intronic
948309011 2:236971276-236971298 CAGTCGGAGCCCAGGCAGCCAGG - Intergenic
948459123 2:238120683-238120705 CAGAGGGAGAAGACGGAGACAGG - Intronic
1171424692 20:25042250-25042272 CAGTGGCAGCAGCCGCAGCCTGG + Intronic
1171437718 20:25136010-25136032 CAGAGGGAGCAGACCGAGCCAGG + Intergenic
1179157266 21:38861522-38861544 CAGCCGGAGAAGACGGCCCCAGG - Intergenic
1180222765 21:46369934-46369956 CAGGCGGAGCTGGAGGAGCCGGG + Intronic
1180473987 22:15687183-15687205 CACTGGGACCAGATGGAGCCAGG + Intergenic
1181057120 22:20265511-20265533 CAGTCCCAGCAGAAGGACCCTGG + Intronic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950533385 3:13566112-13566134 CAGTCCCAGCAGTCAGAGCCTGG - Intronic
953157303 3:40386875-40386897 AAGTCGGAGAGGAGGGAGCCAGG - Intergenic
954414823 3:50388154-50388176 CAGGCGGGGCAGACGCAGGCGGG - Intronic
954794045 3:53152479-53152501 CAGTTAGAGCAGGCTGAGCCAGG + Intergenic
955940578 3:64143581-64143603 CAGTCAGAGCAGACAAACCCAGG + Intronic
959085838 3:101849815-101849837 AAGTCGGAGGAGTCGGAGCCGGG - Exonic
959947139 3:112137117-112137139 CAGCCTGAGCAGACACAGCCTGG + Intergenic
960052431 3:113251237-113251259 CAGTCGGAGCAGGGAGAGACAGG + Intronic
961043348 3:123692833-123692855 GAGACGGAGCAGAGTGAGCCTGG + Exonic
961443415 3:126966384-126966406 CAGACTGAGCAGACTGAGACAGG + Intergenic
961634609 3:128325162-128325184 CAGTCTGTGCAGACCCAGCCAGG + Intronic
963913198 3:150832621-150832643 CTGTCGTAGCAGAGGGATCCGGG + Intergenic
966230103 3:177642272-177642294 CAGTGGGTGCAGACTCAGCCTGG + Intergenic
967970672 3:194996857-194996879 CAGTCAGAGATGACGGGGCCTGG - Intergenic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
970585676 4:17512069-17512091 CATTCGGAGCTGCGGGAGCCGGG - Exonic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
978491460 4:109315676-109315698 CAGTCTGAGCTGTCAGAGCCAGG - Intergenic
980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG + Intergenic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
986043245 5:4013174-4013196 CAGTGGACGCAGACAGAGCCCGG + Intergenic
987862995 5:23508873-23508895 CAGATGGAGAAGACAGAGCCTGG + Intronic
990490057 5:56295424-56295446 CACTCGGAGCAGCCGGCCCCGGG + Intergenic
991975242 5:72178505-72178527 CAGTGGGAGCTGACAGAGCAGGG + Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001975845 5:175997709-175997731 CAGTCTGTACAGGCGGAGCCAGG + Intronic
1002172404 5:177382795-177382817 AAGCCTGAGCAGACGGAGCTTGG + Intronic
1002241580 5:177846063-177846085 CAGTCTGTACAGGCGGAGCCAGG - Intergenic
1002562563 5:180092226-180092248 CAGTCTGAGCACACCGAGTCAGG - Intergenic
1003747997 6:9024365-9024387 CACTCGGAGCAGCCGGGCCCTGG + Intergenic
1006263225 6:32894411-32894433 AAGCGGGAGAAGACGGAGCCTGG + Intergenic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1017760101 6:157562132-157562154 CAGACGGAGCAGCTGCAGCCTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1022533360 7:31080706-31080728 CAATCCCAGCAGCCGGAGCCTGG - Intronic
1024721642 7:52143423-52143445 CAGAGGGAGCAGACACAGCCGGG - Intergenic
1025094229 7:56085186-56085208 CAGGCGGATCAGATGAAGCCGGG - Intronic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029813203 7:103069523-103069545 CAGTCTGAGGAGACAGAGACTGG + Intronic
1032718015 7:134527530-134527552 CAGTGGGAGGAGTTGGAGCCTGG - Intergenic
1035024513 7:155817160-155817182 CAGACGGAGCATCCGGAGGCTGG - Intergenic
1035280127 7:157773160-157773182 CACTCGCAGCAGACGGAGGCAGG + Intronic
1035649367 8:1253327-1253349 CAGTAGCAGCCGATGGAGCCGGG - Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1038482969 8:27914417-27914439 CTGTGGGAGCACCCGGAGCCTGG + Intronic
1039567091 8:38559545-38559567 CAGTGGGAGCACCCAGAGCCAGG - Intergenic
1047779916 8:128102711-128102733 CAGTCAGATCATACGGACCCAGG - Intergenic
1048245513 8:132793086-132793108 CTGTCAGAGCAGCAGGAGCCGGG + Intronic
1049213638 8:141397981-141398003 CAGTCAGCGCAGGCGGAGCAGGG + Intronic
1049831558 8:144704486-144704508 CAGTCAGAGCGGGCTGAGCCAGG + Intergenic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1059447948 9:114350725-114350747 TGGTAGGAGCAGACGGACCCAGG - Intronic
1061382366 9:130266076-130266098 CAGTCTGAGCCGCCGCAGCCAGG + Intergenic
1189380277 X:40497844-40497866 CAGTCCGAGAACACAGAGCCAGG + Intergenic
1189388830 X:40558897-40558919 CACTGGGAGCAGACTGAGCCTGG - Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1193348223 X:80429049-80429071 CAGTCTGAGTTGATGGAGCCGGG + Intronic
1199742817 X:150751585-150751607 CAGTCAGAGGAGACTGAGCAGGG - Intronic