ID: 981550970

View in Genome Browser
Species Human (GRCh38)
Location 4:145940409-145940431
Sequence GGGAAGCTAGATCTTTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981550970_981550977 6 Left 981550970 4:145940409-145940431 CCCCCCAAAAGATCTAGCTTCCC No data
Right 981550977 4:145940438-145940460 AAGTAATGCTATTGAAAGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981550970 Original CRISPR GGGAAGCTAGATCTTTTGGG GGG (reversed) Intergenic
No off target data available for this crispr