ID: 981551145

View in Genome Browser
Species Human (GRCh38)
Location 4:145942537-145942559
Sequence AACAGCTTCCTGATACTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981551143_981551145 -7 Left 981551143 4:145942521-145942543 CCGTCACCATTAATGTAACAGCT No data
Right 981551145 4:145942537-145942559 AACAGCTTCCTGATACTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981551145 Original CRISPR AACAGCTTCCTGATACTTAT AGG Intergenic
No off target data available for this crispr