ID: 981551532

View in Genome Browser
Species Human (GRCh38)
Location 4:145946557-145946579
Sequence CTATAGCCCTCAAGTGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981551532_981551535 20 Left 981551532 4:145946557-145946579 CCACTTGCACTTGAGGGCTATAG No data
Right 981551535 4:145946600-145946622 GCGCTCTCCCTACATCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981551532 Original CRISPR CTATAGCCCTCAAGTGCAAG TGG (reversed) Intergenic
No off target data available for this crispr