ID: 981552066

View in Genome Browser
Species Human (GRCh38)
Location 4:145952049-145952071
Sequence AAGGACCTTGAGAGGTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981552059_981552066 2 Left 981552059 4:145952024-145952046 CCTTGCTCAAACAACCAGCTTTG No data
Right 981552066 4:145952049-145952071 AAGGACCTTGAGAGGTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981552066 Original CRISPR AAGGACCTTGAGAGGTCTGG GGG Intergenic
No off target data available for this crispr