ID: 981556014

View in Genome Browser
Species Human (GRCh38)
Location 4:145995340-145995362
Sequence TACCACTGTATTCCAGCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981556014_981556020 11 Left 981556014 4:145995340-145995362 CCCTAGGCTGGAATACAGTGGTA No data
Right 981556020 4:145995374-145995396 CACTGCCACCTAGAACTCCTGGG No data
981556014_981556019 10 Left 981556014 4:145995340-145995362 CCCTAGGCTGGAATACAGTGGTA No data
Right 981556019 4:145995373-145995395 CCACTGCCACCTAGAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981556014 Original CRISPR TACCACTGTATTCCAGCCTA GGG (reversed) Intergenic
No off target data available for this crispr