ID: 981561976

View in Genome Browser
Species Human (GRCh38)
Location 4:146057998-146058020
Sequence AATTGAATTAAGCCAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981561976_981561982 18 Left 981561976 4:146057998-146058020 CCCAGTCCTGGCTTAATTCAATT No data
Right 981561982 4:146058039-146058061 CACATGCCTGCAGCTTAATATGG No data
981561976_981561983 22 Left 981561976 4:146057998-146058020 CCCAGTCCTGGCTTAATTCAATT No data
Right 981561983 4:146058043-146058065 TGCCTGCAGCTTAATATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981561976 Original CRISPR AATTGAATTAAGCCAGGACT GGG (reversed) Intergenic
No off target data available for this crispr