ID: 981563929

View in Genome Browser
Species Human (GRCh38)
Location 4:146077998-146078020
Sequence CTGGGCTTGTCAACTACTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981563925_981563929 16 Left 981563925 4:146077959-146077981 CCAGTGGCTTAAAATTAATGATT 0: 1
1: 0
2: 2
3: 23
4: 259
Right 981563929 4:146077998-146078020 CTGGGCTTGTCAACTACTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 178
981563924_981563929 27 Left 981563924 4:146077948-146077970 CCTTTTAATTTCCAGTGGCTTAA 0: 1
1: 0
2: 1
3: 21
4: 263
Right 981563929 4:146077998-146078020 CTGGGCTTGTCAACTACTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981563929 Original CRISPR CTGGGCTTGTCAACTACTCC CGG Intergenic