ID: 981563929 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:146077998-146078020 |
| Sequence | CTGGGCTTGTCAACTACTCC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 184 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 178} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981563925_981563929 | 16 | Left | 981563925 | 4:146077959-146077981 | CCAGTGGCTTAAAATTAATGATT | 0: 1 1: 0 2: 2 3: 23 4: 259 |
||
| Right | 981563929 | 4:146077998-146078020 | CTGGGCTTGTCAACTACTCCCGG | 0: 1 1: 0 2: 0 3: 5 4: 178 |
||||
| 981563924_981563929 | 27 | Left | 981563924 | 4:146077948-146077970 | CCTTTTAATTTCCAGTGGCTTAA | 0: 1 1: 0 2: 1 3: 21 4: 263 |
||
| Right | 981563929 | 4:146077998-146078020 | CTGGGCTTGTCAACTACTCCCGG | 0: 1 1: 0 2: 0 3: 5 4: 178 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981563929 | Original CRISPR | CTGGGCTTGTCAACTACTCC CGG | Intergenic | ||