ID: 981566377

View in Genome Browser
Species Human (GRCh38)
Location 4:146105906-146105928
Sequence TCATTAAGGCAGGCAGTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566377_981566383 1 Left 981566377 4:146105906-146105928 CCCAAAACTGCCTGCCTTAATGA No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data
981566377_981566387 22 Left 981566377 4:146105906-146105928 CCCAAAACTGCCTGCCTTAATGA No data
Right 981566387 4:146105951-146105973 GGAACAATCATGAACCTTCAAGG No data
981566377_981566381 -10 Left 981566377 4:146105906-146105928 CCCAAAACTGCCTGCCTTAATGA No data
Right 981566381 4:146105919-146105941 GCCTTAATGAAGATGCTCCCGGG No data
981566377_981566388 23 Left 981566377 4:146105906-146105928 CCCAAAACTGCCTGCCTTAATGA No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981566377 Original CRISPR TCATTAAGGCAGGCAGTTTT GGG (reversed) Intergenic
No off target data available for this crispr