ID: 981566378

View in Genome Browser
Species Human (GRCh38)
Location 4:146105907-146105929
Sequence TTCATTAAGGCAGGCAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566378_981566387 21 Left 981566378 4:146105907-146105929 CCAAAACTGCCTGCCTTAATGAA No data
Right 981566387 4:146105951-146105973 GGAACAATCATGAACCTTCAAGG No data
981566378_981566388 22 Left 981566378 4:146105907-146105929 CCAAAACTGCCTGCCTTAATGAA No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566378_981566383 0 Left 981566378 4:146105907-146105929 CCAAAACTGCCTGCCTTAATGAA No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981566378 Original CRISPR TTCATTAAGGCAGGCAGTTT TGG (reversed) Intergenic
No off target data available for this crispr