ID: 981566379

View in Genome Browser
Species Human (GRCh38)
Location 4:146105916-146105938
Sequence GGGAGCATCTTCATTAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566379_981566387 12 Left 981566379 4:146105916-146105938 CCTGCCTTAATGAAGATGCTCCC No data
Right 981566387 4:146105951-146105973 GGAACAATCATGAACCTTCAAGG No data
981566379_981566383 -9 Left 981566379 4:146105916-146105938 CCTGCCTTAATGAAGATGCTCCC No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data
981566379_981566388 13 Left 981566379 4:146105916-146105938 CCTGCCTTAATGAAGATGCTCCC No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981566379 Original CRISPR GGGAGCATCTTCATTAAGGC AGG (reversed) Intergenic