ID: 981566382 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:146105920-146105942 |
| Sequence | GCCCGGGAGCATCTTCATTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981566382_981566387 | 8 | Left | 981566382 | 4:146105920-146105942 | CCTTAATGAAGATGCTCCCGGGC | No data | ||
| Right | 981566387 | 4:146105951-146105973 | GGAACAATCATGAACCTTCAAGG | No data | ||||
| 981566382_981566388 | 9 | Left | 981566382 | 4:146105920-146105942 | CCTTAATGAAGATGCTCCCGGGC | No data | ||
| Right | 981566388 | 4:146105952-146105974 | GAACAATCATGAACCTTCAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981566382 | Original CRISPR | GCCCGGGAGCATCTTCATTA AGG (reversed) | Intergenic | ||