ID: 981566382

View in Genome Browser
Species Human (GRCh38)
Location 4:146105920-146105942
Sequence GCCCGGGAGCATCTTCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566382_981566388 9 Left 981566382 4:146105920-146105942 CCTTAATGAAGATGCTCCCGGGC No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566382_981566387 8 Left 981566382 4:146105920-146105942 CCTTAATGAAGATGCTCCCGGGC No data
Right 981566387 4:146105951-146105973 GGAACAATCATGAACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981566382 Original CRISPR GCCCGGGAGCATCTTCATTA AGG (reversed) Intergenic
No off target data available for this crispr