ID: 981566383

View in Genome Browser
Species Human (GRCh38)
Location 4:146105930-146105952
Sequence GATGCTCCCGGGCCTACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566378_981566383 0 Left 981566378 4:146105907-146105929 CCAAAACTGCCTGCCTTAATGAA No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data
981566376_981566383 21 Left 981566376 4:146105886-146105908 CCATGGTCATGATCGGGTGGCCC No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data
981566377_981566383 1 Left 981566377 4:146105906-146105928 CCCAAAACTGCCTGCCTTAATGA No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data
981566379_981566383 -9 Left 981566379 4:146105916-146105938 CCTGCCTTAATGAAGATGCTCCC No data
Right 981566383 4:146105930-146105952 GATGCTCCCGGGCCTACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981566383 Original CRISPR GATGCTCCCGGGCCTACACA TGG Intergenic
No off target data available for this crispr