ID: 981566384

View in Genome Browser
Species Human (GRCh38)
Location 4:146105936-146105958
Sequence ATTGTTCCATGTGTAGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566384_981566387 -8 Left 981566384 4:146105936-146105958 CCCGGGCCTACACATGGAACAAT No data
Right 981566387 4:146105951-146105973 GGAACAATCATGAACCTTCAAGG No data
981566384_981566388 -7 Left 981566384 4:146105936-146105958 CCCGGGCCTACACATGGAACAAT No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981566384 Original CRISPR ATTGTTCCATGTGTAGGCCC GGG (reversed) Intergenic