ID: 981566388

View in Genome Browser
Species Human (GRCh38)
Location 4:146105952-146105974
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981566377_981566388 23 Left 981566377 4:146105906-146105928 CCCAAAACTGCCTGCCTTAATGA No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566378_981566388 22 Left 981566378 4:146105907-146105929 CCAAAACTGCCTGCCTTAATGAA No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566385_981566388 -8 Left 981566385 4:146105937-146105959 CCGGGCCTACACATGGAACAATC No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566382_981566388 9 Left 981566382 4:146105920-146105942 CCTTAATGAAGATGCTCCCGGGC No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566384_981566388 -7 Left 981566384 4:146105936-146105958 CCCGGGCCTACACATGGAACAAT No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data
981566379_981566388 13 Left 981566379 4:146105916-146105938 CCTGCCTTAATGAAGATGCTCCC No data
Right 981566388 4:146105952-146105974 GAACAATCATGAACCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type