ID: 981568422

View in Genome Browser
Species Human (GRCh38)
Location 4:146125792-146125814
Sequence CTTACAGCCTTGAATGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981568422_981568426 25 Left 981568422 4:146125792-146125814 CCTTTATCATTCAAGGCTGTAAG No data
Right 981568426 4:146125840-146125862 AGACATATCTTTAAGTTCCAAGG No data
981568422_981568424 1 Left 981568422 4:146125792-146125814 CCTTTATCATTCAAGGCTGTAAG No data
Right 981568424 4:146125816-146125838 AAATCTACATTTTTCTCTGGAGG No data
981568422_981568425 2 Left 981568422 4:146125792-146125814 CCTTTATCATTCAAGGCTGTAAG No data
Right 981568425 4:146125817-146125839 AATCTACATTTTTCTCTGGAGGG No data
981568422_981568423 -2 Left 981568422 4:146125792-146125814 CCTTTATCATTCAAGGCTGTAAG No data
Right 981568423 4:146125813-146125835 AGAAAATCTACATTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981568422 Original CRISPR CTTACAGCCTTGAATGATAA AGG (reversed) Intergenic
No off target data available for this crispr