ID: 981568477

View in Genome Browser
Species Human (GRCh38)
Location 4:146126385-146126407
Sequence CTCACTGGTCAGAGTTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981568477_981568481 14 Left 981568477 4:146126385-146126407 CCATAACAACTCTGACCAGTGAG No data
Right 981568481 4:146126422-146126444 AATGCCTTCTGAGGCTCAGATGG No data
981568477_981568480 5 Left 981568477 4:146126385-146126407 CCATAACAACTCTGACCAGTGAG No data
Right 981568480 4:146126413-146126435 GCTAATCTAAATGCCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981568477 Original CRISPR CTCACTGGTCAGAGTTGTTA TGG (reversed) Intergenic
No off target data available for this crispr