ID: 981570005

View in Genome Browser
Species Human (GRCh38)
Location 4:146141958-146141980
Sequence GGGACCCTGACTAATACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981570005_981570007 -7 Left 981570005 4:146141958-146141980 CCACCTGTATTAGTCAGGGTCCC No data
Right 981570007 4:146141974-146141996 GGGTCCCAACAGAAAACAGAAGG No data
981570005_981570010 16 Left 981570005 4:146141958-146141980 CCACCTGTATTAGTCAGGGTCCC No data
Right 981570010 4:146141997-146142019 CACCCTTAAACTTGTAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981570005 Original CRISPR GGGACCCTGACTAATACAGG TGG (reversed) Intergenic
No off target data available for this crispr