ID: 981573197

View in Genome Browser
Species Human (GRCh38)
Location 4:146175811-146175833
Sequence GGTGAGCCGCACCGCTGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981573190_981573197 9 Left 981573190 4:146175779-146175801 CCTGGAGTGAGGGTTCTGGTTCC 0: 1
1: 1
2: 0
3: 19
4: 167
Right 981573197 4:146175811-146175833 GGTGAGCCGCACCGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 74
981573186_981573197 25 Left 981573186 4:146175763-146175785 CCGGGCTCGTGGGGCGCCTGGAG 0: 1
1: 0
2: 1
3: 21
4: 180
Right 981573197 4:146175811-146175833 GGTGAGCCGCACCGCTGCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981573197 Original CRISPR GGTGAGCCGCACCGCTGCGC GGG Exonic
900643124 1:3696761-3696783 CTTGAGCCCCACCGCTGCTCGGG - Intronic
901199173 1:7457050-7457072 GGTGAGGGGCACGGCGGCGCAGG - Intronic
903139301 1:21329358-21329380 GGTGAGTCTCACCTCTGTGCTGG - Intronic
914237338 1:145823961-145823983 GGTGGGCCGCACCGAGGCGGCGG - Exonic
917931976 1:179828876-179828898 GGTGAGCAGAGCCGCTGGGCAGG - Intergenic
918260257 1:182789544-182789566 GGGGAGCCGGGGCGCTGCGCCGG + Intronic
920013368 1:202886371-202886393 GGTGAGCCGCTCCGCCCGGCAGG - Intronic
1065964386 10:30759232-30759254 GGTGAGCCCCACCACTGAGCTGG + Intergenic
1068713200 10:60156461-60156483 GGTGAGCCCCAGCACTGTGCTGG + Intronic
1072102198 10:92239773-92239795 GGTGAGCGGCGCTGCTGCGGGGG + Exonic
1073535068 10:104269064-104269086 GCTCAGCCGCACTGCTGGGCAGG + Intronic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1076572578 10:131442184-131442206 GGTGAGCTGCCCAGCTGTGCAGG + Intergenic
1077197471 11:1288602-1288624 GGTGAGCTGCACGCCTGGGCGGG - Exonic
1077298259 11:1835984-1836006 GGTGAAGGGCCCCGCTGCGCAGG + Exonic
1088718385 11:112570511-112570533 AATGAGCCGCACAGCTGTGCAGG - Intergenic
1090799090 11:130159693-130159715 GGTGAGCCGGGCAGGTGCGCAGG + Exonic
1094473215 12:30822582-30822604 GGTGAGCTGCACTGCTGCCCTGG + Intergenic
1098060421 12:66555091-66555113 GGTGAGACCCACTGCTGTGCTGG + Intronic
1108922638 13:55694164-55694186 GGTGAGACTCACTGCTGTGCTGG + Intergenic
1119301056 14:73571357-73571379 GGTGAGAAGCACCGCTGGGTAGG - Intronic
1122275153 14:100587295-100587317 GGTGAGCGGCGCGGCTGCCCTGG - Intronic
1126183876 15:45811638-45811660 GGTGAGACCCAGCGCTGTGCTGG + Intergenic
1133343583 16:5055224-5055246 GGTGAGCTGCGCTGCTGCCCTGG - Exonic
1136389068 16:29950934-29950956 GGTGAGACCCACTGCTGTGCTGG - Intronic
1138229116 16:55324779-55324801 GGTGAGGCGCGGCGCGGCGCGGG - Exonic
1142698256 17:1645210-1645232 GCTGAGCTGCAGTGCTGCGCAGG - Exonic
1145761162 17:27426087-27426109 GGTGAGCCGGACCCCTGGGCTGG - Intergenic
1145798379 17:27668645-27668667 GGTGAGCCTAACCCCTGGGCTGG + Intergenic
1147536639 17:41326312-41326334 GGTGAGCCAGACCCCTGGGCTGG - Intergenic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1147869328 17:43576568-43576590 AGTGAGCCACAGCGCTGGGCTGG + Intronic
1152180197 17:78814994-78815016 GGTGTGCAGCAACGCTGTGCAGG + Intronic
1158403566 18:57141819-57141841 GGTGAGCCCAACCGCCCCGCAGG - Intergenic
1160930324 19:1567176-1567198 GGGGAGCCGCGCCGCAGCCCAGG - Intronic
1164722996 19:30445608-30445630 GGTGAGCCGCTCCACCACGCCGG + Exonic
925314878 2:2913878-2913900 GGTGAGCCCCACAGCTCAGCAGG + Intergenic
948503953 2:238415429-238415451 GGTCAGCCACACCTCTGCCCGGG + Intergenic
1170086858 20:12543939-12543961 GGTGAGACCCAGTGCTGCGCTGG - Intergenic
1170190361 20:13639043-13639065 GGTGAGCCGCTCCGAAGCGGAGG - Intergenic
1174059422 20:47821914-47821936 GGTGAGCCACCCCCCTGCGAGGG - Intergenic
1180001841 21:44998649-44998671 GGTGAGCCGCTGCTCTGCACAGG - Intergenic
1181054856 22:20256125-20256147 GATGCGCCGCCCCACTGCGCAGG + Intronic
1183339680 22:37273311-37273333 GGGGAGCCCCAGCGCTGCCCTGG + Intergenic
1183949285 22:41343673-41343695 GGTGGGCCTCACAGCTGCACGGG + Intronic
1184091941 22:42297516-42297538 GGTGAGCCCCATGGCTGGGCTGG + Intronic
1184332115 22:43833754-43833776 GGTGAGCCACACGGCTGGGCAGG + Intronic
1184556617 22:45236630-45236652 GGTGGGCCTCACCTCTGCGCAGG + Intronic
1185278815 22:49961234-49961256 GGTGAGTCGGACCGCCGGGCGGG + Exonic
950215312 3:11154554-11154576 GGTGAGTCGCAGCGGGGCGCGGG + Intronic
952770288 3:36993592-36993614 GGTGAACCGCATCGCGGCGGGGG + Exonic
952888739 3:38027585-38027607 GGTGAGCCGCATAGCTCCCCAGG + Intronic
953913763 3:46905521-46905543 GGAGAGGCGCACCTCTGCCCTGG - Intergenic
955863496 3:63357203-63357225 GGTGAGCTCCACAGCTGCTCTGG + Intronic
965962104 3:174441160-174441182 TGTGGGCCGCACCCCTGCGCGGG + Intronic
968046741 3:195628325-195628347 GCTCAGCTGCACCGCTGAGCTGG + Intergenic
973292346 4:48483323-48483345 GGTGAACCCAATCGCTGCGCCGG - Exonic
978031015 4:103939754-103939776 GGTGAGACCCACTGCTGTGCTGG + Intergenic
981573197 4:146175811-146175833 GGTGAGCCGCACCGCTGCGCGGG + Exonic
984832394 4:183987685-183987707 GGTGAGCTCCACCGCTGCCCGGG + Intronic
994449829 5:99928682-99928704 GGTGAGCAGCTCCACTCCGCTGG + Intergenic
999253642 5:150197045-150197067 GATGAGCAGCATGGCTGCGCCGG - Exonic
1001057297 5:168460276-168460298 GGTCAGCCGCACAGCAGGGCTGG - Intronic
1001998020 5:176177486-176177508 GGTGATCCACACAGCAGCGCAGG - Intergenic
1006444856 6:34074424-34074446 GTTGAGCCTCACAGCTGCCCTGG - Intronic
1007473365 6:42104685-42104707 GGGGAGCCGCACCGAGGCCCAGG - Exonic
1010528995 6:76942795-76942817 GGTGAGACCCAGTGCTGCGCTGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1020117927 7:5486874-5486896 GGTGAGCCGCACAACAGCCCGGG + Intronic
1026110295 7:67454138-67454160 AGTGAGCCCCGCAGCTGCGCTGG + Intergenic
1028135671 7:87220502-87220524 GGTGATCCGCAGCGCTGCGACGG - Exonic
1030723525 7:112898256-112898278 GGTGAGCCCCAGTGCTGTGCTGG + Intronic
1034862792 7:154614138-154614160 GGAGAGCCACACTGCTGTGCTGG - Intronic
1035388405 7:158489641-158489663 GGTGAGCCCCGCCGCTGGCCTGG - Intronic
1042737509 8:72005300-72005322 GGCGAGCAGCACCGAAGCGCGGG + Intronic
1046317955 8:112531395-112531417 GGTGAGCCTCAGTGCTGTGCTGG + Intronic
1048862916 8:138737077-138737099 GGTGGGCCGCAGCGCAGCGCTGG - Intronic
1049192783 8:141298001-141298023 GGTGGGCCACAGCGCTGCCCGGG + Intronic
1049765918 8:144355163-144355185 AGTGAGCCCCACAGCTGGGCGGG + Intronic
1060182784 9:121545734-121545756 GCTGAGGCGCAGCGCTGGGCTGG + Intergenic
1062372132 9:136245454-136245476 GGTGAGGCGCGCCCCCGCGCGGG - Exonic
1192495961 X:71616823-71616845 GGTGGGCCGCACGGCTCTGCGGG - Exonic
1197380738 X:125736160-125736182 GGTGAGACGCAGTGCTGTGCTGG - Intergenic
1197567620 X:128107372-128107394 GGTGAGCCCCAGTGCTGTGCTGG - Intergenic
1199189049 X:144949515-144949537 GGTGAGCCCCACTACTGTGCTGG + Intergenic