ID: 981573226

View in Genome Browser
Species Human (GRCh38)
Location 4:146175918-146175940
Sequence CTTTCCGGGGCTGCCTCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981573226_981573242 20 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573242 4:146175961-146175983 GGGCTCCGGGAAGGGACCGCTGG 0: 1
1: 0
2: 0
3: 22
4: 216
981573226_981573244 24 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573244 4:146175965-146175987 TCCGGGAAGGGACCGCTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 283
981573226_981573233 -6 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573233 4:146175935-146175957 GGAAAGGGCCTGCGGTGAACAGG 0: 1
1: 1
2: 0
3: 13
4: 141
981573226_981573234 -2 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573234 4:146175939-146175961 AGGGCCTGCGGTGAACAGGCTGG 0: 1
1: 0
2: 4
3: 13
4: 182
981573226_981573240 11 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573240 4:146175952-146175974 AACAGGCTGGGGCTCCGGGAAGG 0: 1
1: 0
2: 0
3: 18
4: 290
981573226_981573235 -1 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573235 4:146175940-146175962 GGGCCTGCGGTGAACAGGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 144
981573226_981573247 28 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573247 4:146175969-146175991 GGAAGGGACCGCTGGGTGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 377
981573226_981573246 27 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573246 4:146175968-146175990 GGGAAGGGACCGCTGGGTGGCGG 0: 1
1: 0
2: 0
3: 42
4: 387
981573226_981573238 6 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573238 4:146175947-146175969 CGGTGAACAGGCTGGGGCTCCGG 0: 1
1: 0
2: 0
3: 17
4: 231
981573226_981573243 21 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573243 4:146175962-146175984 GGCTCCGGGAAGGGACCGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 135
981573226_981573241 12 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573241 4:146175953-146175975 ACAGGCTGGGGCTCCGGGAAGGG 0: 1
1: 0
2: 7
3: 34
4: 413
981573226_981573239 7 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573239 4:146175948-146175970 GGTGAACAGGCTGGGGCTCCGGG 0: 1
1: 0
2: 6
3: 27
4: 380
981573226_981573236 0 Left 981573226 4:146175918-146175940 CCGGGCGAGGCAGCCCCGGAAAG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 981573236 4:146175941-146175963 GGCCTGCGGTGAACAGGCTGGGG 0: 1
1: 0
2: 3
3: 18
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981573226 Original CRISPR CTTTCCGGGGCTGCCTCGCC CGG (reversed) Exonic