ID: 981573397

View in Genome Browser
Species Human (GRCh38)
Location 4:146177228-146177250
Sequence AGAGTACTCACTTGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981573397_981573402 11 Left 981573397 4:146177228-146177250 CCTGCCTCCCAAGTGAGTACTCT 0: 1
1: 0
2: 0
3: 19
4: 129
Right 981573402 4:146177262-146177284 GGCAGTCTCTCACTGAACTGTGG 0: 1
1: 0
2: 0
3: 7
4: 119
981573397_981573401 -10 Left 981573397 4:146177228-146177250 CCTGCCTCCCAAGTGAGTACTCT 0: 1
1: 0
2: 0
3: 19
4: 129
Right 981573401 4:146177241-146177263 TGAGTACTCTGTGCTGTATCAGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981573397 Original CRISPR AGAGTACTCACTTGGGAGGC AGG (reversed) Intronic
900597070 1:3485076-3485098 AGAGCACAAACTCGGGAGGCAGG - Intergenic
903121602 1:21219960-21219982 AGACTTCGCACTTGTGAGGCGGG + Exonic
903343045 1:22666684-22666706 GGAGTACTGACTTGGGAGTCAGG - Intergenic
903653961 1:24937596-24937618 AGAGCACTCACTTTGGAGTCAGG - Intronic
904469014 1:30724244-30724266 AGAGCACAGACTTGGGAGCCAGG + Intergenic
905249554 1:36639111-36639133 AGAGGCCTCACTGGGGAGACTGG - Intergenic
905878811 1:41450263-41450285 AGAGTTCTGGCTCGGGAGGCAGG + Intergenic
907258100 1:53195680-53195702 AGAGTACTGGATTGGGAGTCAGG - Intergenic
907423628 1:54364467-54364489 AGAGTGCTAGGTTGGGAGGCAGG - Intronic
907861570 1:58358680-58358702 ACAGTTCTCAGTTGGGAGGCTGG - Intronic
909563751 1:77032693-77032715 AGAGCACTGGCTTGGGAGTCAGG - Intronic
910988060 1:93025908-93025930 AGAGGACTCACTTGGTAGAGAGG + Intergenic
912117025 1:106419353-106419375 AGAGGTGCCACTTGGGAGGCAGG - Intergenic
919979068 1:202631120-202631142 AGAGCACTGGATTGGGAGGCAGG - Intronic
1067155268 10:43776236-43776258 AGAGTCCTCACTTGCATGGCAGG + Intergenic
1068117937 10:52755305-52755327 AATCCACTCACTTGGGAGGCAGG - Intergenic
1069813747 10:71180500-71180522 AACGAACTCACTTGGGAGGATGG - Intergenic
1069869011 10:71521831-71521853 AGAGGGCCCACCTGGGAGGCGGG - Intronic
1072173083 10:92886588-92886610 AGAGCACTGACTTTGGAGTCAGG + Intronic
1074322111 10:112412977-112412999 AGAGTCCTGAATTGGGAGGGAGG + Intronic
1074419148 10:113293829-113293851 AGAGTTCTCATATGGGAGGTAGG + Intergenic
1074768703 10:116719311-116719333 AGGGTACTCACTTAAAAGGCGGG - Intronic
1076034162 10:127185046-127185068 AGAGTGCTCCCTGGGGAGTCAGG + Intronic
1077738926 11:4823186-4823208 AGAGTATTCACTTCAGAGGAGGG - Intronic
1078357685 11:10644656-10644678 AGGGTTCTCACTGGGGAAGCTGG + Intronic
1078593551 11:12666823-12666845 AGAGTAGTCACTGGGAAAGCTGG - Intergenic
1078594945 11:12677450-12677472 AGTATACTCACTTGGGAGACTGG + Intronic
1080061227 11:27958933-27958955 AGAGCACTGGCTTGGGAGACAGG - Intergenic
1080067722 11:28039012-28039034 AGAGGACTGAATTGGGAGTCAGG + Intronic
1082223749 11:49675663-49675685 AGAGTTCCCACTTGGGAGCTTGG + Intergenic
1086335426 11:85796127-85796149 AGAGCACTGACTTGGGAGTCGGG + Intronic
1086625305 11:88943599-88943621 AGAGTTCCCACTTGGGAGCTTGG - Intronic
1088734699 11:112719094-112719116 AGGATACTCACTGGGGAGGTGGG + Intergenic
1088961014 11:114664772-114664794 AGGATACTCTCTTGGGAGGCAGG + Intergenic
1089072461 11:115710981-115711003 AGCGTGCTCCCTTGGGAGGATGG + Intergenic
1089736591 11:120553974-120553996 AGAGAAGCCACTTTGGAGGCTGG + Intronic
1095329678 12:40943595-40943617 AGAATACTCATTTGGGAAGATGG + Exonic
1097793556 12:63840235-63840257 AGAGTACCCACTTTGGAGACAGG + Intergenic
1101788015 12:107903163-107903185 GGAAGACTCACTTTGGAGGCTGG - Intergenic
1101847604 12:108375126-108375148 TGAGTACCCACTGGGGAGGGAGG + Intergenic
1101868678 12:108544179-108544201 AGAGCTCTCACCTGGGAGTCAGG + Intronic
1102117040 12:110410656-110410678 AGAGGACTCCTTTGGGAGACCGG - Intergenic
1103352219 12:120292094-120292116 AGAATATTCGCTTGGGACGCTGG + Intergenic
1103703887 12:122861256-122861278 AGAGAGCTCCCTGGGGAGGCTGG + Intronic
1105562677 13:21509078-21509100 AAAACACTGACTTGGGAGGCAGG - Intronic
1106172005 13:27296497-27296519 AGAGTGCTCACTTGGTGGGGGGG - Intergenic
1107150776 13:37108137-37108159 AAAGTACTGGCTTTGGAGGCAGG - Intergenic
1111432981 13:88167833-88167855 AGGAATCTCACTTGGGAGGCAGG + Intergenic
1112692803 13:101916321-101916343 AGAGTGCTCAGAAGGGAGGCCGG + Intronic
1114307572 14:21437563-21437585 AGAGTATAAACTTGGGAGGGAGG + Intronic
1115226423 14:31107606-31107628 AGAGAACTGACTTGGGAGCTTGG - Exonic
1117540217 14:56739597-56739619 TGTGTACTCACCTTGGAGGCAGG - Intergenic
1118036803 14:61877104-61877126 ACAGTACTACCTGGGGAGGCGGG + Intergenic
1119170770 14:72534820-72534842 AGAGTGCTCATCTGAGAGGCAGG - Intronic
1119690235 14:76665996-76666018 AAAGTAAGCCCTTGGGAGGCAGG - Intergenic
1119900161 14:78252838-78252860 GGAGTACCCACTTGCGAGGAGGG + Intronic
1125330109 15:38574024-38574046 AGATAACACACTTGGGTGGCTGG - Intergenic
1129122977 15:73414184-73414206 AGAGTCTTAACCTGGGAGGCAGG - Intergenic
1129769184 15:78192830-78192852 TGAGGACTCCCTTGGGATGCAGG + Intronic
1131122265 15:89830025-89830047 ACAGTTCTCACTCGGGGGGCTGG + Intergenic
1133858949 16:9576019-9576041 AGACAACTCAATTAGGAGGCTGG - Intergenic
1137591324 16:49695765-49695787 AGAGTACTCGCTCTGGAGCCTGG + Intronic
1137755460 16:50898659-50898681 AGAGTCCACAGTTGGGAGGATGG - Intergenic
1139301567 16:65949297-65949319 AGAGCACTCACTTTGGAGTCAGG + Intergenic
1140407736 16:74722113-74722135 AGAGGAGTCCCTTGGGAGGGAGG - Intronic
1141369198 16:83471650-83471672 AGTTTACTCACTGGGGAGGCTGG - Intronic
1143392708 17:6569479-6569501 AGGGTCCTATCTTGGGAGGCAGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1146688474 17:34857091-34857113 GGAGGACTCACTTAGGAGGGGGG + Intergenic
1148445402 17:47734151-47734173 AGAGGACTCACAAGGGAGACGGG + Intronic
1148895826 17:50838473-50838495 ATCGTACCCACTTGGCAGGCAGG - Intronic
1149257378 17:54841922-54841944 AGAGTACTCACTTTGTGGGAGGG - Intergenic
1149339894 17:55674413-55674435 AGATTTCTCACTTAAGAGGCAGG - Intergenic
1150438413 17:65171925-65171947 AGACTACATCCTTGGGAGGCAGG - Intronic
1150588284 17:66538305-66538327 AGAGCAGTCAGTTGGGTGGCAGG - Intronic
1150588559 17:66540499-66540521 AGAGCAGTCAGTTGGGTGGCGGG + Intronic
1153766306 18:8378328-8378350 AGAGACCTAACTTGGGAAGCAGG - Exonic
1156521015 18:37722325-37722347 AGAAAACTCACTTAGGAGGCTGG + Intergenic
1157893081 18:51437437-51437459 ATTGTACACACTTGGGAGGCTGG + Intergenic
1158031068 18:52965809-52965831 AGAGAACTCATTTGGAAGACAGG - Intronic
1158379030 18:56907763-56907785 AGAGTCCTCACTTGGTAGAAAGG + Intronic
1160670376 19:359735-359757 AGTGTCCTCACATGGCAGGCAGG + Intergenic
1167197722 19:48042204-48042226 AGAATTCTGACTTGGGAGTCAGG - Intronic
929646309 2:43632174-43632196 AGAATGCTCAATGGGGAGGCAGG - Intergenic
933391099 2:81667916-81667938 TGAGTTCTCCCTTGCGAGGCTGG + Intergenic
938232301 2:129671619-129671641 ACAGTGCTCACTTGGAAGGCAGG + Intergenic
938380593 2:130834335-130834357 AGACTGCCCACTAGGGAGGCTGG - Intergenic
948576319 2:238952795-238952817 AGTGTACTCACTAGAGAGGCTGG - Intergenic
1168830678 20:843807-843829 TGGGTACTCACCTGGGAGGAGGG - Intronic
1170121726 20:12919530-12919552 AGAGTAGCCACATGGGATGCTGG - Intergenic
1173658750 20:44718680-44718702 TGAGTCCTCACTTGGGAAGCAGG + Intronic
1174082408 20:47979786-47979808 AGAGCACTGACTTGGGAGTCAGG - Intergenic
1175834887 20:61987112-61987134 AGAGCACTGGATTGGGAGGCAGG - Intronic
1181677655 22:24467218-24467240 AGAGCACTAGCTTGGGAGTCAGG + Intergenic
1182962980 22:34493771-34493793 AGAGTTTGGACTTGGGAGGCAGG - Intergenic
1183257159 22:36770084-36770106 AGAGGATTCACTGGGGAGGGAGG + Intronic
1183524508 22:38315562-38315584 AGTGTACACACTCGGGAAGCTGG - Intronic
1183730456 22:39615588-39615610 AGAGCACTTAGTTGGGAGGGAGG - Intronic
1184368923 22:44070265-44070287 AGAGCACTGACTAGGGAGCCAGG - Intronic
950322347 3:12068728-12068750 AGAGAACTCATTAGGAAGGCTGG - Intronic
952179719 3:30904931-30904953 TGAGTGCTCACTTGACAGGCTGG - Intergenic
952209838 3:31219160-31219182 ATAGTACTCACTTGGGCTGCAGG - Intergenic
959126835 3:102300116-102300138 AGAGTCCTCACATGGCAGGAGGG + Intronic
960444561 3:117731922-117731944 AGAAAACTCACTGGGGAGGTAGG + Intergenic
960487899 3:118275751-118275773 AGAGGCCTCACTGGGGAGCCAGG - Intergenic
961997397 3:131260254-131260276 AGAGCACTCATTTGGGAGTCAGG + Intronic
965013356 3:163125692-163125714 AGAGGACTCAAGTGGGAGGCAGG - Intergenic
968075722 3:195815244-195815266 AGCGTGCTCACTTGAGAGGTAGG - Intergenic
971773400 4:30928214-30928236 AGAGTACTAACTTGCTGGGCAGG - Intronic
974200740 4:58636472-58636494 ACAGGACTCACTTGGGAGCTGGG - Intergenic
976445182 4:85122533-85122555 AGAGTGCTCAGTTGGATGGCAGG + Intergenic
980862456 4:138516034-138516056 AAAGTAGTCACTGGGGAGGTAGG - Intergenic
981573397 4:146177228-146177250 AGAGTACTCACTTGGGAGGCAGG - Intronic
983982282 4:174013162-174013184 AGAGTAATGTCCTGGGAGGCAGG - Intergenic
984184063 4:176520846-176520868 GTACTAGTCACTTGGGAGGCAGG + Intergenic
986064490 5:4222542-4222564 AGAGTACTCATTTGCAGGGCTGG + Intergenic
986156996 5:5186059-5186081 AGAGGTCTTCCTTGGGAGGCTGG - Exonic
990380902 5:55221343-55221365 AGAGTACTGACTTGGGCAACAGG + Intronic
991342238 5:65624308-65624330 AGAGTCCTCAACTGAGAGGCGGG + Exonic
992093829 5:73342239-73342261 GAAGCCCTCACTTGGGAGGCAGG + Intergenic
992180764 5:74196132-74196154 AGAGTTCTTAATTGAGAGGCTGG + Intergenic
997234566 5:132265398-132265420 AGGGTACCCACTTGGGAGCCTGG + Intronic
999241541 5:150130673-150130695 AGAGCACTGAGTTAGGAGGCGGG + Intronic
999465128 5:151796171-151796193 AGGTTACTCACTTGGGTTGCTGG + Intronic
999672697 5:153971647-153971669 AGAGTACTCAATTCGAAGTCAGG + Intergenic
1007826980 6:44607882-44607904 AGAGTTCTCTCTGGGGAGCCAGG - Intergenic
1009823197 6:68831251-68831273 AGGCTACTCACTTAGGCGGCGGG + Intronic
1012189080 6:96259422-96259444 AAAATACTCACTTGAGAGGGAGG + Intergenic
1013205438 6:107940826-107940848 TGAGTACTTACCTGGGACGCGGG + Intronic
1015633302 6:135252412-135252434 AGAATGCTCACTTTGGTGGCAGG - Intergenic
1015764678 6:136703497-136703519 AGGGTTCTCACAGGGGAGGCTGG - Intronic
1016880728 6:148909720-148909742 AAAGTAATCACTTAGAAGGCAGG - Intronic
1020872610 7:13650754-13650776 AGAGTCCTCATTTGGGAAACAGG - Intergenic
1023216244 7:37866119-37866141 AGTGTACTGGCTTGGGAGTCAGG + Intronic
1029259107 7:99289393-99289415 AGAGGGCTCACCTTGGAGGCGGG - Intergenic
1030197198 7:106863924-106863946 GGAATACTCCCTTAGGAGGCTGG - Intergenic
1030860718 7:114623009-114623031 TGAGTGCTCATTTGGGAGACAGG - Intronic
1037507522 8:19546613-19546635 AGAATACTGACTTGGGAGAGTGG - Intronic
1044075541 8:87817979-87818001 TCATTACTCACTTGTGAGGCTGG + Intergenic
1044970025 8:97610333-97610355 AGAGCTCTCACGTGGAAGGCAGG - Intergenic
1047480008 8:125272919-125272941 AGAGAACTGACTTGGGAGCTAGG + Intronic
1049169440 8:141149910-141149932 AGAATACAGACTTGGGAGACTGG + Intronic
1052977560 9:34422503-34422525 AAAGCAGTCACTTGGAAGGCTGG + Intronic
1056016803 9:82397729-82397751 AGAGCACTCACCTGGGAAACTGG + Intergenic
1059259372 9:112961219-112961241 AAAGCACTTACTTGAGAGGCTGG - Intergenic
1186930197 X:14380894-14380916 AGAGTACTGAGTGGTGAGGCAGG + Intergenic
1196356316 X:114797655-114797677 AGTGTTCTCACTTGGGAAGTTGG + Intronic
1199374757 X:147094856-147094878 AGAGTACTTGCTTGGTGGGCAGG + Intergenic
1201950805 Y:19561799-19561821 AGATTAGTCACTGGGCAGGCAGG + Intergenic