ID: 981574318

View in Genome Browser
Species Human (GRCh38)
Location 4:146188390-146188412
Sequence CCCTGCCCCCCAAGTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981574318_981574328 -3 Left 981574318 4:146188390-146188412 CCCCTAGGACTTGGGGGGCAGGG No data
Right 981574328 4:146188410-146188432 GGGTTGGGGGGCGGCTGTACTGG 0: 1
1: 0
2: 1
3: 14
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981574318 Original CRISPR CCCTGCCCCCCAAGTCCTAG GGG (reversed) Intronic