ID: 981574361

View in Genome Browser
Species Human (GRCh38)
Location 4:146188763-146188785
Sequence CAAAGTATGAGACTTTTAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981574358_981574361 3 Left 981574358 4:146188737-146188759 CCACTAAGCAGAACATTAGGTAA 0: 1
1: 0
2: 0
3: 7
4: 138
Right 981574361 4:146188763-146188785 CAAAGTATGAGACTTTTAACGGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981574361 Original CRISPR CAAAGTATGAGACTTTTAAC GGG Intronic
900430867 1:2602656-2602678 CAGAGTCTGAGACTTTCAAGTGG + Intronic
905048240 1:35025802-35025824 TTAATTATGTGACTTTTAACGGG + Intronic
907566696 1:55442178-55442200 CAAAGTCCGAGAGCTTTAACTGG + Intergenic
909153056 1:72033662-72033684 CAATGTATGAGACATCTAACTGG + Intronic
909954098 1:81756210-81756232 GAAGATATGAGACTTTTCACTGG - Intronic
912575097 1:110663122-110663144 CAAGGTATTAGACATTTAAGAGG - Intergenic
912646790 1:111400583-111400605 CAAAATATGTGTATTTTAACAGG - Intergenic
913277151 1:117149470-117149492 GAAATTATGAGAGTATTAACTGG - Intronic
918976435 1:191492701-191492723 AAGAGTATGAGACTTTTCAGAGG - Intergenic
919296992 1:195714929-195714951 CAAAATATGATACTTTTCAGTGG - Intergenic
921501797 1:215913419-215913441 CAAAGTCTTAGTCATTTAACAGG - Intronic
924912007 1:248523216-248523238 CAGAATATGTCACTTTTAACTGG + Intergenic
1062926575 10:1320303-1320325 AAAAGTATGTGAATTTTAAAAGG + Intronic
1064664572 10:17637756-17637778 CAAAGTATGAAACTCTTAACAGG - Intergenic
1067359916 10:45569596-45569618 CAAAGTATGAGAGCTGAAACAGG + Intronic
1070364710 10:75725407-75725429 CAAGGTATGAGACCTTTTAAAGG - Intronic
1072018679 10:91376965-91376987 TAAGAGATGAGACTTTTAACAGG + Intergenic
1072533420 10:96341044-96341066 CAAAGTTTAAGAATATTAACAGG - Intergenic
1079262743 11:18899230-18899252 CAAAGTCTGTGTCTTTTAATTGG - Intergenic
1079695762 11:23480580-23480602 CAAAGCATGAGAGTTTAAATAGG - Intergenic
1081111679 11:39142940-39142962 AAAAATATGAAACTTTTAACAGG + Intergenic
1083017416 11:59469684-59469706 CAAACTATTAGACTTCTAAGAGG + Intergenic
1085678084 11:78544125-78544147 TACAGCATTAGACTTTTAACTGG + Intronic
1089156953 11:116409941-116409963 CAAAATATGTGACTTTGAAGGGG + Intergenic
1091932488 12:4407373-4407395 CTAAGTAAGTGACTTTTACCTGG + Intergenic
1092937217 12:13375305-13375327 CAAAGCAATAGAATTTTAACTGG + Intronic
1093395942 12:18682358-18682380 CAAAGTCAGGGACTTTTAATAGG - Intergenic
1094593838 12:31846010-31846032 GAAAGGATGAGATTTTTAAAAGG - Intergenic
1095561288 12:43569293-43569315 CAAAGCATGAGAGTTCAAACAGG + Intergenic
1097619041 12:61917882-61917904 CAAAGAATGAGACTTTATTCAGG + Intronic
1097667640 12:62498534-62498556 AAAATTATGAAACTTTTAAAAGG - Intronic
1098640381 12:72831909-72831931 CATAGTCTGAGACTTTTGATTGG + Intergenic
1100715008 12:97296211-97296233 CAAAGTCAGAGACCTTTAATTGG - Intergenic
1101576868 12:106005793-106005815 CAAAGTCTATGACTTTTAATAGG - Intergenic
1105918365 13:24938514-24938536 CAAAGTGTGAGTCTGTGAACTGG + Intergenic
1109219089 13:59623106-59623128 CAAAGTGTTAGATTTTTAAAAGG + Intergenic
1109924139 13:69112037-69112059 CAAAGTTTTAGAATTTTATCAGG + Intergenic
1110080796 13:71308258-71308280 CAAACTATGTGAGTTCTAACTGG - Intergenic
1110160087 13:72366603-72366625 CAAAGTTTGAGGCTTATATCAGG - Intergenic
1111072713 13:83189031-83189053 CAAAGAATGGGACTATTAATGGG - Intergenic
1113059157 13:106302358-106302380 CACAGTAGTAGACATTTAACTGG - Intergenic
1114765219 14:25362850-25362872 GTAAGTATGACACTTTGAACTGG - Intergenic
1116543470 14:46131774-46131796 TAAAATTTGAGACTTTTCACAGG + Intergenic
1118169252 14:63370222-63370244 CAAAGTATGTGATTGTTAAAGGG - Intergenic
1118914288 14:70088921-70088943 CAATATATGAGAGTTTTAGCAGG - Intronic
1125629306 15:41134179-41134201 CAAAGTTTGGGAGTTTTAAGAGG - Intergenic
1126537968 15:49788387-49788409 CATATTTTGAGACTTTTAAGTGG + Intergenic
1128056042 15:64700871-64700893 CCAAGTCTCAGACTCTTAACTGG - Intronic
1130640388 15:85668111-85668133 GAAAGGCAGAGACTTTTAACAGG - Intronic
1130938739 15:88490717-88490739 CCAAGTAAGAGACTTTGAAAAGG - Intergenic
1131979939 15:97985196-97985218 CAAAATTTGAGCCTTTTAAATGG + Intergenic
1137544560 16:49392109-49392131 CAAAGTTTGGGAATTTTATCAGG - Intronic
1139395451 16:66635082-66635104 CATAGTATGAGCATTTTAACTGG + Intronic
1140574553 16:76150604-76150626 CAACTTATGATACTTTCAACAGG - Intergenic
1145118464 17:20233703-20233725 CAAAGGATGTGAATTTTAAGTGG + Intronic
1145201403 17:20948457-20948479 CAAAGGATGTGAATTTTAAGTGG + Intergenic
1149175797 17:53868495-53868517 CAAAATAGAAGAATTTTAACAGG - Intergenic
1151041882 17:70872330-70872352 CAACTTAAGAGAATTTTAACAGG + Intergenic
1153668665 18:7389749-7389771 AAAAGAATGAGAATTTTAAAGGG + Intergenic
1155058764 18:22209904-22209926 AAAAATATGAGAATTTTAAATGG - Intergenic
1156177602 18:34565315-34565337 CAAAGAGTGATAGTTTTAACAGG + Intronic
1156760800 18:40586854-40586876 CTAAAAATGAGAGTTTTAACAGG + Intergenic
1158268749 18:55689191-55689213 CAAAGTATCAGACTTTGAAGAGG + Intergenic
1161471486 19:4458951-4458973 CAAAGTACGCCACTATTAACTGG - Intergenic
1161899670 19:7109201-7109223 CAAAGTATGCCACTTTTGGCCGG - Intergenic
926852228 2:17211785-17211807 AAATGTATGAAACTTTTAATGGG + Intergenic
927392760 2:22613464-22613486 CAAAGTTTGAGACTTCTAAACGG + Intergenic
928859446 2:35839236-35839258 CAGAGTATGAGGCTTTTTACAGG - Intergenic
930099000 2:47588707-47588729 CAAAGTTTGGGAGTTTTAAGAGG + Intergenic
931126615 2:59285422-59285444 CAAAGTAAGAGAATGTGAACTGG + Intergenic
932508364 2:72259646-72259668 CAATGTATGAGAGCTCTAACTGG + Intronic
935009695 2:99121888-99121910 AAAACTATGAGACTTTTAGGAGG - Intronic
937616345 2:123926797-123926819 CATAGTATGAGAAATGTAACTGG + Intergenic
937629996 2:124090802-124090824 CAAAGTCTCAGATTTCTAACAGG - Intronic
939522609 2:143249291-143249313 TAAATTATGAGACTTTTTTCTGG - Intronic
940020488 2:149151372-149151394 TAAAGTATGAGACTGAGAACTGG - Intronic
942845506 2:180419759-180419781 CAAAGTATAGTACTTTTACCAGG + Intergenic
1170993706 20:21330537-21330559 CAAAGTATGAGACTACTTACTGG - Exonic
1175024890 20:55891417-55891439 CAAAATTAGAGAATTTTAACTGG - Intergenic
1177686975 21:24449589-24449611 CAATCTATGAGAATTTAAACAGG - Intergenic
1177968799 21:27762013-27762035 CAAAATATGAGACTTGAAAAGGG - Intergenic
1180216849 21:46329223-46329245 CAAAGTATGAGTGTTTAATCAGG - Intronic
949186001 3:1192109-1192131 AAAATTAGGAGACTTCTAACAGG - Intronic
949322615 3:2827922-2827944 CAAAATGTGAGATTTTTAAATGG + Intronic
950249106 3:11449208-11449230 CAAAATATGAGCCTATTAGCTGG + Intronic
956857449 3:73289300-73289322 TAAAGTATGAGATATTGAACTGG - Intergenic
957877968 3:86174052-86174074 CAAAGTATGAGACTTTAAGAAGG + Intergenic
958197069 3:90255133-90255155 CAAAGTATGTCACTGTTAGCTGG - Intergenic
958420487 3:93924963-93924985 CAAAGTATGTCACTGTTAGCTGG - Intronic
959862707 3:111234272-111234294 CAAAGTTTGACACTTTCAACTGG - Intronic
960217460 3:115059290-115059312 CAAAGTATTAGACATTTTTCTGG + Intronic
961706368 3:128789300-128789322 CAAAGTTTGAAATTTCTAACTGG - Intronic
962402716 3:135075124-135075146 CAAAGTATGAGCCTTTAAGCAGG + Intronic
963563646 3:146900083-146900105 TAAAGTATCAGAATCTTAACTGG + Intergenic
966376408 3:179300483-179300505 CAAAGTAAGAGCCTTGTAAGAGG - Intergenic
966955409 3:184872537-184872559 AACAGAATGAGACTTCTAACAGG - Intronic
968151553 3:196340769-196340791 CCAGGTATGAGACCTTTATCAGG + Intergenic
970104036 4:12560019-12560041 CAAGATATGATACTTTTAAGGGG + Intergenic
970282781 4:14476569-14476591 CAAGCTATGAGACTTTCAAGGGG + Intergenic
970549964 4:17169803-17169825 CAAACTTTGAAATTTTTAACAGG - Intergenic
970900202 4:21150139-21150161 GATGGTATGAGACTTTTCACAGG + Intronic
972435387 4:39028925-39028947 CACTGTGTGAGACTTTTAATGGG - Intronic
973602599 4:52556989-52557011 CAAAGTGCTAGACTTTTTACAGG - Intergenic
973956369 4:56067441-56067463 CAAAGAATTAGATTTTTAAGAGG - Intergenic
974662732 4:64915153-64915175 CAATGTATGAAAATTTTAATTGG + Intergenic
975614374 4:76231798-76231820 TAAAGAATGCCACTTTTAACAGG - Intronic
975873838 4:78812540-78812562 TAAAATTTCAGACTTTTAACAGG - Intronic
975903787 4:79185635-79185657 CAAAATGAGAGACTTTTAATTGG - Intergenic
978249721 4:106615999-106616021 AAAAGTAAGACACTTTCAACAGG + Intergenic
980270529 4:130578188-130578210 TAAAATATGAGACTTGTAAATGG - Intergenic
981574361 4:146188763-146188785 CAAAGTATGAGACTTTTAACGGG + Intronic
987319667 5:16756785-16756807 AAATGTTTGAGACTTTAAACTGG - Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
990079666 5:51897882-51897904 CAATGTGTGAGACTTTCAATTGG - Intergenic
991089701 5:62682446-62682468 CAAACTATGAGATTTTTAAATGG - Intergenic
991127114 5:63081681-63081703 CAAAGTAAGAGACTTGAAAAAGG - Intergenic
991228519 5:64301892-64301914 CAAAGTGTGATTCTTTTACCAGG + Intronic
992226921 5:74627787-74627809 CAAAGTGTGGGACGTTTCACAGG + Exonic
992711646 5:79464180-79464202 CAAAGAATGACAATTTTAACAGG + Intronic
992956278 5:81911849-81911871 CAAAGTATCAGATTTTTCAAAGG + Intergenic
994665544 5:102700134-102700156 CCAAATATAAGACTTTTCACAGG + Intergenic
994793503 5:104263192-104263214 CAAACTATAAAACTTTTAAGTGG + Intergenic
996615042 5:125431109-125431131 GAAAGCCTGAGACTTTTGACGGG - Intergenic
996786960 5:127248249-127248271 CAAAATATTATACTTTTAAAAGG + Intergenic
999913518 5:156232184-156232206 CAAAGTATGAGGATATTAAATGG - Intronic
1001326679 5:170733261-170733283 CAGATTATGAGACCTTTAAATGG + Intronic
1001676652 5:173523661-173523683 CAAAGTAAGAGTCTTTTAGAGGG + Intergenic
1003342860 6:5238861-5238883 CATAGTCCGAGACTATTAACTGG + Intronic
1003846635 6:10181033-10181055 AAATGTATGAGACTTTTATCAGG - Intronic
1005116977 6:22349699-22349721 CATAGTATGTGACTTTTATGTGG + Intergenic
1005324347 6:24684434-24684456 CAAGGTATGAGGATTTTAACCGG - Intronic
1011413706 6:87094108-87094130 CAAAATATCTGACTTTTGACTGG + Intronic
1011972150 6:93239179-93239201 CAAAATATTAGATTTATAACTGG - Intergenic
1013584085 6:111563226-111563248 CATAGAATGTGACTTCTAACAGG - Intronic
1015065413 6:129020421-129020443 CAAAGTATGAGACTTAAAGAGGG + Intronic
1015385064 6:132612765-132612787 GAGAGTATGTGAGTTTTAACTGG - Intergenic
1017909868 6:158783383-158783405 CAAAGTAGGAAACTTTTTAAAGG - Intronic
1018264285 6:162005201-162005223 CAAAGTTTGAGACTTTATCCTGG - Intronic
1019854455 7:3590652-3590674 CTAAGGATGAGACTATTAAAAGG - Intronic
1021426595 7:20506905-20506927 AAAAATATGAGAAGTTTAACAGG + Intergenic
1023463404 7:40426086-40426108 CACAGTAAGAGACTTGTTACAGG + Intronic
1024282172 7:47728038-47728060 AAAAGTATGAGTCTTTCAATTGG - Intronic
1025833257 7:65073054-65073076 CAAAGTAGGAGACAGATAACAGG + Intergenic
1025903019 7:65762560-65762582 CAAAGTAGGAGACAGATAACAGG + Intergenic
1028728948 7:94122652-94122674 AAAATTATGAGACTTTGAGCGGG - Intergenic
1029937056 7:104436902-104436924 AAAAGTTTGAGACTTTTTAGAGG + Intronic
1031184431 7:118457946-118457968 CAAAGAAAGATACTTTTACCAGG + Intergenic
1032696462 7:134340879-134340901 GAAAGGATGAGAATTTTAAGAGG - Intergenic
1032714631 7:134496466-134496488 AAGAGTATCAGACTTTTAGCTGG + Intergenic
1033845498 7:145426937-145426959 CAAAATATCAGAGTTTTATCAGG + Intergenic
1035132290 7:156666909-156666931 CAATGTCTGGGACTTTTAGCTGG - Intronic
1036006655 8:4672381-4672403 CAAAGTGTGAGAATGTGAACAGG - Intronic
1039498928 8:38001724-38001746 CAAAGTTGGAGAGTTTTAAGAGG + Intergenic
1041911032 8:63088278-63088300 CAAAGTATGAGACTTAAAGAAGG + Intergenic
1042013440 8:64277850-64277872 CAAAGAAAGAGGCTTTTGACAGG + Intergenic
1047131493 8:122025667-122025689 CAAACAATGTTACTTTTAACAGG + Intergenic
1050054460 9:1637334-1637356 GAAAGTATGAGAATTTTCAGAGG - Intergenic
1050706864 9:8410072-8410094 CAATGAATGAGAATTTTAAAAGG - Intronic
1052366377 9:27616191-27616213 CCAAGTATTTGAATTTTAACAGG + Intergenic
1054942278 9:70756007-70756029 CAAAGTTTGTGTCTTTTAATTGG - Intronic
1055275930 9:74615549-74615571 AAAAATATGATACTTTTCACTGG - Intronic
1055907385 9:81310224-81310246 CAAAGCATGAGAAACTTAACGGG - Intergenic
1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG + Intronic
1058741323 9:107945390-107945412 GGAAGTGTGAGACCTTTAACTGG + Intergenic
1060443159 9:123660737-123660759 CAAAGTAAAAGAATTTTAAAAGG + Intronic
1186085206 X:5981233-5981255 CAAAGCATGACACTTTTCATTGG - Intronic
1187361536 X:18632271-18632293 CAAAGTATGCACCTTTTAGCAGG - Intronic
1189125094 X:38437513-38437535 TTAAATATGAGACTTTTATCTGG + Intronic
1189226584 X:39418650-39418672 CAAATTGTGAGACTCTTGACAGG - Intergenic
1192054773 X:67761764-67761786 GAAAGTATGAGAATTATAAAAGG - Intergenic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1192792489 X:74396700-74396722 CAAAGCATGAGAGTTCAAACAGG + Intergenic
1195287181 X:103396611-103396633 CATAGTATGAGGCTTTCATCAGG - Intergenic
1195640733 X:107171955-107171977 CAATGTATGAGACTTGTGAAGGG - Intronic
1197536620 X:127696634-127696656 CAAATTATGAAGCCTTTAACTGG - Intergenic
1197615753 X:128689594-128689616 CAAAATATTATAATTTTAACTGG - Intergenic
1198738222 X:139811223-139811245 CAGAGAATGAGACTTATAATAGG - Intronic
1198846668 X:140919511-140919533 GAAAATGTGAGACTTTTAAATGG - Intergenic