ID: 981574564

View in Genome Browser
Species Human (GRCh38)
Location 4:146191186-146191208
Sequence TCTTTTAAGGAGAAAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 551}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981574560_981574564 23 Left 981574560 4:146191140-146191162 CCAGTATGTAAGTACAAATCACC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG 0: 1
1: 0
2: 4
3: 61
4: 551
981574561_981574564 2 Left 981574561 4:146191161-146191183 CCAATTTGCTCTTTTATAAATGA 0: 1
1: 0
2: 5
3: 57
4: 604
Right 981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG 0: 1
1: 0
2: 4
3: 61
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981574564 Original CRISPR TCTTTTAAGGAGAAAATGGA TGG Intronic
900540678 1:3201151-3201173 TCTTTTGAGGAGGACAGGGATGG + Intronic
901116518 1:6849671-6849693 AGTTTTGAGGAGGAAATGGAGGG + Intronic
902177681 1:14663278-14663300 TCTTTTAAGTAGTACATGGGAGG + Intronic
902421284 1:16282520-16282542 TTTTTAAAAGAGAAAATGGCCGG - Intronic
902716416 1:18275898-18275920 TCCTCTTAGGAGAAAAGGGAAGG - Intronic
903128093 1:21261297-21261319 TCTTTGAAGGAGGCAAAGGAAGG - Intronic
903287795 1:22287719-22287741 TCTCTGCAGGAGAAAATGGGTGG + Intergenic
903672353 1:25044043-25044065 TCAAATAGGGAGAAAATGGAAGG + Intergenic
903701536 1:25252332-25252354 TCATTTAAGTATAAAATAGAAGG + Intronic
904654685 1:32035566-32035588 TGTTCTAAGTGGAAAATGGAGGG - Intronic
905010013 1:34740797-34740819 ACTTTTAAAGAGAAAATAGGAGG - Intronic
906765376 1:48426090-48426112 GCTTGTAATGAGAAAATGTAGGG + Intronic
906837572 1:49100444-49100466 TCTTCAAAGGAGAATCTGGATGG + Intronic
906842667 1:49157045-49157067 TCTTTTAATGAGAAAAAGTTTGG + Intronic
906973326 1:50542483-50542505 TCATTTAAAGATAAAATGCATGG + Intronic
907355758 1:53872365-53872387 TATATTAAGGTGAAAATAGAAGG - Intronic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
908135938 1:61132628-61132650 ACAATTAAGGAGAAAAGGGATGG + Intronic
909555042 1:76944243-76944265 TATTTTAAAGAGAGAATAGATGG + Intronic
910014016 1:82498215-82498237 ACTTTTGAGGAGGAAAGGGAGGG + Intergenic
910179230 1:84463227-84463249 TTTCTGAACGAGAAAATGGAAGG - Intergenic
910680561 1:89859843-89859865 TCTTGGAAGCACAAAATGGAAGG - Intronic
911701933 1:100963488-100963510 TGGATTAAGGAGAAAATGAATGG + Intronic
912838647 1:113019439-113019461 TCCTTAAAGGAGGATATGGATGG - Intergenic
913077711 1:115354885-115354907 TTTTTTCAAGAGAAAAAGGAGGG - Intergenic
913081305 1:115389513-115389535 TCCATTTAAGAGAAAATGGATGG - Intergenic
913521796 1:119651614-119651636 GCTTTCAAGTATAAAATGGATGG + Intergenic
914003295 1:143710760-143710782 GCTTATCAGGAGAGAATGGAAGG - Intergenic
914215980 1:145628850-145628872 GCTATTAAGGAGGAAATAGATGG + Intronic
914468547 1:147951482-147951504 TCTATTAAGGAGGAAATAGATGG + Intronic
915729127 1:158040658-158040680 AGTTTTCAGGTGAAAATGGAGGG + Intronic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916900813 1:169220973-169220995 TCTATTGATGAGAAAATGGAAGG - Intronic
917179879 1:172284661-172284683 TCTCTGTAGAAGAAAATGGAAGG - Intronic
918602161 1:186376026-186376048 TCTTTTCAAGAGAAAAAGGAAGG + Intronic
918626895 1:186666114-186666136 TTTTTTAAGGAAAAGATGCAAGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919162317 1:193846511-193846533 TGTTTTGAGAATAAAATGGAAGG + Intergenic
919947038 1:202327172-202327194 TTTATAGAGGAGAAAATGGAAGG + Intergenic
920018796 1:202937200-202937222 TTTTTTTAAAAGAAAATGGATGG + Intergenic
921323677 1:213969176-213969198 TGTATTAAGCAGAGAATGGAGGG + Intergenic
923616486 1:235542639-235542661 TCATTTAAAGAAAAAATGCAGGG - Intergenic
923852399 1:237811412-237811434 TGTTTAAAGGAGAGAAAGGATGG - Intronic
923876580 1:238055983-238056005 TCTATTTAGGAAAAAATGGGAGG - Intergenic
924171717 1:241349285-241349307 TTTCTTAAGGAGACAATGGGTGG - Intronic
924215621 1:241818560-241818582 TCTTTTGATGAGAAAAAGGAAGG - Intergenic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
1063345000 10:5303388-5303410 TCTTTGATGGAGAAGATGAAAGG + Intergenic
1063628505 10:7713209-7713231 TCTATTAAGGAGAAAACTGTGGG + Exonic
1063952361 10:11235409-11235431 TCTTTTAAAGAGAAAATTCAAGG - Intronic
1064037556 10:11926826-11926848 TCTTCCAAGGAGGAATTGGAGGG + Intronic
1064305339 10:14160733-14160755 TGTTTTCAGGAGAAACTGAATGG - Intronic
1064305602 10:14163494-14163516 TGTTTTCAGGAGAAACTGAATGG + Intronic
1064678513 10:17785768-17785790 TCTTCTAAGTAGCAAAGGGAGGG - Intronic
1065179765 10:23113196-23113218 TCTTTTAACAAGTAAATGCAGGG + Intronic
1065652616 10:27909099-27909121 TATTTTAAGTAGCATATGGAAGG - Intronic
1065949897 10:30642276-30642298 TCTTTTTGGGAGCAAAAGGAAGG + Intergenic
1068392715 10:56419335-56419357 TCTTTAAAGGAGAAAAGAGGAGG - Intergenic
1068395293 10:56453545-56453567 TCATTTCAGAAGAGAATGGAAGG + Intergenic
1068583754 10:58773307-58773329 TCTTTTAACGAGAAAGTGTGTGG - Intronic
1068869379 10:61927154-61927176 TCTCTTGAGCAGAAAATGAAGGG - Intronic
1069977006 10:72222022-72222044 TTTTTTAAAGAAAAAATGGCCGG - Intronic
1070433206 10:76361839-76361861 TGGTACAAGGAGAAAATGGATGG - Intronic
1071694593 10:87858416-87858438 TTTTTCAAAGAGAAAATGCATGG - Intergenic
1072495178 10:95949920-95949942 TCATTTATGAACAAAATGGAAGG + Intergenic
1073279350 10:102340857-102340879 ACATTTTAGGAGAAAATGGGAGG + Intronic
1073453631 10:103623621-103623643 TCTTATAAGGACAAAAGGGTAGG + Intronic
1073785524 10:106885268-106885290 GTTTTTAAGGAGAAAATTGGGGG + Intronic
1074229980 10:111524020-111524042 TTTTTTGGGGAGAAAATGGAAGG + Intergenic
1077869455 11:6249877-6249899 TCTTTTAGGGAGATAAGGAAAGG + Intergenic
1077960398 11:7071101-7071123 TCCTTTACAGAGAAAGTGGAGGG + Intronic
1078270590 11:9791004-9791026 ACTTTTCAAGAGAAAATGGAAGG + Intronic
1078372359 11:10759455-10759477 TGTATTCAAGAGAAAATGGAAGG + Intronic
1078499651 11:11858269-11858291 TTTCTTACCGAGAAAATGGAGGG - Intronic
1079031162 11:16987398-16987420 TGTCTTAAGGAGGAAAAGGAGGG - Intronic
1079390064 11:20014444-20014466 TCTTTTAAACAGAAAATTAAAGG - Intronic
1079653047 11:22954674-22954696 TCTTTTAAAAAGAAAGTGAAGGG - Intergenic
1081444009 11:43112229-43112251 TGTTTTAAAAAGAAAAGGGAAGG - Intergenic
1082309781 11:50632513-50632535 GTTTTTAAGGAGAAAAAGAAAGG + Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1082893246 11:58162859-58162881 TCTTCTGAGGACAAAATGGAAGG + Intronic
1083106399 11:60362396-60362418 TCTTTTCAGGACAAAATGTCAGG + Intronic
1084069259 11:66723530-66723552 TCTCTTTAGGAGAAAGGGGAGGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084788759 11:71459794-71459816 TCTTCTAAGCAGCACATGGATGG + Intronic
1085204105 11:74720009-74720031 TCTTTTCAGGAGGAACTGGGAGG + Intronic
1085277585 11:75309935-75309957 TGTTTTGAGGAGCAAGTGGAAGG - Intronic
1086662363 11:89435685-89435707 TCATTTGAGGATAAAATAGAAGG + Intronic
1086777235 11:90853677-90853699 TCATTTAGGGAGAAAAATGATGG + Intergenic
1087128456 11:94648633-94648655 AATTTTGAGGAGAAAATGTAAGG - Intergenic
1087190490 11:95249276-95249298 TATCTTAAGAAGAAAATGGGAGG + Intergenic
1087270937 11:96111011-96111033 TCTTTGATGGAGAAAATGATAGG - Intronic
1087676727 11:101171471-101171493 TAGTTTAAGGAAGAAATGGAAGG - Intergenic
1087937203 11:104048720-104048742 TTTTTGAATGAGAAAATGAATGG - Intronic
1087947864 11:104186189-104186211 TCTGTGAAGGGGAAAATGTAGGG - Intergenic
1088381567 11:109199069-109199091 TTTTTAATGGAGAGAATGGAAGG - Intergenic
1088425671 11:109698729-109698751 TCTTGAAAAGAGCAAATGGATGG - Intergenic
1090223285 11:125050066-125050088 TCTCTTAAGGTGGAAATGAAGGG + Intergenic
1090490142 11:127153494-127153516 CCTTTTCAGGAGAAAAAGGTAGG - Intergenic
1090517393 11:127443706-127443728 TATTTTTAGGAGAAAATAGGAGG + Intergenic
1090550151 11:127810538-127810560 TCTGTTAAGTAAAAAAGGGATGG - Intergenic
1090901403 11:131035223-131035245 TCTTTGAATGAGAAGAAGGATGG + Intergenic
1090984848 11:131757087-131757109 TCCTTGAAGGAGATAATGTATGG - Intronic
1091112383 11:132981901-132981923 CCTTGTAAGGAGAAAAATGAAGG + Intronic
1091291358 11:134441829-134441851 TATTTAAATGAGAAAATTGAGGG + Intergenic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093232297 12:16561328-16561350 TCTTTAAAGTTGATAATGGAGGG + Intronic
1094059512 12:26298786-26298808 TCTTTTAATGAGCAATTGAAGGG - Intronic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1095043423 12:37470549-37470571 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1095470650 12:42533475-42533497 ACTTTTAAGGAGCAAATGTTAGG - Intronic
1095492991 12:42755835-42755857 TCCTTTAAACAGAAAATGAAAGG - Intergenic
1095532895 12:43210899-43210921 TCCTTTGAGGAGAACATGGCTGG + Intergenic
1095752221 12:45726753-45726775 TCATTTAAGGGCAGAATGGAGGG - Intergenic
1096945820 12:55408844-55408866 GCTTTTAGGTAGAAAGTGGAAGG + Intergenic
1096961540 12:55583246-55583268 TCTTTGCATGAGAAAATGCAGGG + Intergenic
1098398257 12:70045308-70045330 TCTGTTAGGGAGAAAATAAAAGG + Intergenic
1098706618 12:73699225-73699247 TCTTATAAAGAGAAAATAGGAGG - Intergenic
1098939812 12:76521052-76521074 GCTTTTAGGAAGAAAATGGCTGG - Intronic
1099149066 12:79085940-79085962 TTAATTAAGGAGAAAATTGAGGG + Intronic
1100447222 12:94672196-94672218 TCTTGAAATGAGTAAATGGAAGG - Intergenic
1100900138 12:99229981-99230003 TCTTTTAAGAAAATAATAGATGG + Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101311000 12:103579211-103579233 TACTATGAGGAGAAAATGGAGGG + Intergenic
1101637406 12:106556133-106556155 TCTTCTAAAGAAAAAAAGGAAGG - Intronic
1101663151 12:106784897-106784919 GAGGTTAAGGAGAAAATGGATGG - Intronic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1103619776 12:122180051-122180073 TTTTTCAAGGAGGAAATGGTTGG + Intronic
1105622414 13:22081158-22081180 TGTCATAAGGAGAAAATGCATGG + Intergenic
1106110020 13:26768688-26768710 TCTTGAAAAGAGAAAATGGAAGG + Intergenic
1106275401 13:28200872-28200894 ACATTTAAGGAGTAAATGGATGG - Intronic
1106476460 13:30102466-30102488 TCTTTTAGGCAGAATCTGGAAGG - Intergenic
1106584790 13:31047585-31047607 ATTTTTAAGGAGGAAAAGGAAGG + Intergenic
1106766237 13:32916649-32916671 TTTTTTAAGTAGAAAAATGAGGG - Intergenic
1106933385 13:34691428-34691450 TCTTCTAAGGAAGAAATGGAAGG + Intergenic
1107197722 13:37673515-37673537 TTTTTTAAAGAGAAAAGGAAAGG + Intronic
1107299487 13:38950080-38950102 TCTTTTAAGGATAATTTGGTAGG + Intergenic
1107468322 13:40667961-40667983 TTTTTTAGGAAGAATATGGAAGG + Intergenic
1107692057 13:42963080-42963102 CCTTTGAAGGATAAAATGGAAGG + Intronic
1108427133 13:50313748-50313770 TCTTTTGACCAGAAAATGTATGG + Intronic
1108523228 13:51263191-51263213 GCTTTTCAGGAGCAGATGGACGG - Intronic
1108912389 13:55571946-55571968 TCTTCTAATGAAAAGATGGATGG + Intergenic
1109098789 13:58151733-58151755 TCTCTTAAGGAGATAAATGATGG + Intergenic
1109213863 13:59565366-59565388 TCTTTAAAAGAAAAAGTGGATGG - Intergenic
1109504092 13:63276306-63276328 TCTTGTAAGCAGCAAATGGTTGG - Intergenic
1109531955 13:63661595-63661617 TATTATAAGTAGAAAATGCATGG - Intergenic
1110034382 13:70662234-70662256 TCTTATAAGATGAAAATAGAAGG - Intergenic
1110459121 13:75724671-75724693 TCTTCTAAGGAGAAAAACAATGG - Intronic
1110674394 13:78223071-78223093 TTTTCTAATGAGACAATGGAAGG + Intergenic
1111033906 13:82644785-82644807 TTTTTTAAGCAGAAAATATAAGG - Intergenic
1111083835 13:83347234-83347256 TCTCTAAAGAAGAAAATTGAAGG + Intergenic
1111169492 13:84507318-84507340 TCTTTTGTGAAAAAAATGGATGG - Intergenic
1111958556 13:94784100-94784122 TCTTTTTAAGAGAAAGTAGAGGG + Intergenic
1114049428 14:18910517-18910539 TCTTTTAAAGAAGAAAAGGAAGG - Intergenic
1114113135 14:19491414-19491436 TCTTTTAAAGAAGAAAAGGAAGG + Intergenic
1114550529 14:23530284-23530306 TCAATGAAGGAGAAAATGGATGG + Intronic
1115092837 14:29598933-29598955 GGTTTTAAGGGAAAAATGGAAGG + Intronic
1115201205 14:30856012-30856034 TCCTTTATGGAGAAAAAAGAGGG + Intergenic
1115751281 14:36493154-36493176 ACTGTTAAACAGAAAATGGAGGG - Intronic
1117052964 14:51880521-51880543 TCTTTTGAGTAGAATATGGCTGG + Intronic
1118047296 14:61984647-61984669 TCTTTTAGTGAGAAATTGGAAGG + Intergenic
1118850865 14:69582307-69582329 TCCATTAAGAAGAAAAAGGAGGG - Intergenic
1119492543 14:75049169-75049191 TCCTGTAAGGAGGAAATGCATGG - Exonic
1119540498 14:75435118-75435140 TCCTCTAAGGAGAACAGGGAAGG - Intronic
1120108348 14:80522543-80522565 TCTTTCAAGGGGAAGAAGGATGG + Intronic
1120803492 14:88719680-88719702 TTTTTTAAACAGAAAATGGTGGG + Intronic
1121147237 14:91594708-91594730 TCTTGTGAAGAGAAAATAGAGGG + Intronic
1121887944 14:97561829-97561851 CCTTTCAAGGAGTAAATGGGTGG - Intergenic
1202941969 14_KI270725v1_random:158161-158183 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1124406162 15:29393929-29393951 TTTTTCCAGGGGAAAATGGAGGG - Intronic
1124600711 15:31130808-31130830 TCTTTTAAGGATAATTTGGCAGG - Intronic
1125060408 15:35414580-35414602 TGTTTCAAGGAAAAAATAGAAGG - Intronic
1125151299 15:36535638-36535660 TCTATAAAGGAGAAAACTGATGG + Intergenic
1126928712 15:53622466-53622488 TCTTTTACAGGGACAATGGATGG + Intronic
1127229666 15:56976123-56976145 TTTTTAAAGTGGAAAATGGAAGG + Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1128004154 15:64222386-64222408 TCTTCTAAGGAGAAAAAAAACGG - Intronic
1128289550 15:66466976-66466998 CCTTTTAAAGAGAAACTGCAGGG + Intronic
1129628640 15:77233240-77233262 TGGATTGAGGAGAAAATGGAAGG - Intronic
1130067450 15:80616431-80616453 GCCTTTAGGGAGATAATGGAGGG - Intergenic
1131018570 15:89078436-89078458 TCTGTTTAGGAGCAAAAGGAAGG - Intergenic
1131307091 15:91254669-91254691 TCTTTTACCTATAAAATGGAGGG + Intronic
1132412970 15:101598982-101599004 TCTTTGAAGAGGAAAAGGGAAGG - Intergenic
1133929621 16:10221694-10221716 TCTATGGAGGAGAAAATGTAGGG - Intergenic
1134904957 16:17972263-17972285 TGTTTTCAGGAGAAAGGGGAAGG - Intergenic
1135117583 16:19736760-19736782 TCTGCAGAGGAGAAAATGGAGGG + Intronic
1135896845 16:26413560-26413582 TGATTTAAAGAAAAAATGGAAGG - Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136987444 16:35122420-35122442 TGTATTAAGAAGGAAATGGAGGG + Intergenic
1137468101 16:48729591-48729613 TCTTTTAGGAAGAAGAAGGAGGG + Intergenic
1137547500 16:49414639-49414661 TCATTTAAGGAGAAAGTGGGGGG - Intergenic
1137788987 16:51158573-51158595 TTTATGAAGCAGAAAATGGAGGG - Intergenic
1137789485 16:51162974-51162996 TGTTTTCAGAAGAAAAGGGAGGG + Intergenic
1138812091 16:60163312-60163334 TCATTAAAGGAGAAAATCAAAGG + Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1140189326 16:72801772-72801794 TCTATTAAAAAGAAAATAGATGG - Intronic
1140521500 16:75585757-75585779 TCTTTCAAGGAGAATTTGGAAGG + Intergenic
1140990965 16:80210968-80210990 TCTGTGAAGGAGAAATTGCATGG + Intergenic
1141455145 16:84136270-84136292 TGCTTTAAGGAGGAAATGAAAGG + Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1145124814 17:20291546-20291568 TCTTTTAAAAAAAAAATGGTGGG - Intronic
1146479327 17:33192054-33192076 TTTATTAAGAAGAAAATGGAGGG - Intronic
1146544271 17:33724878-33724900 TTTTTTAAGAAAAAAATGAACGG - Intronic
1146569918 17:33943464-33943486 TGTTTTGAGGATGAAATGGAGGG - Intronic
1147237614 17:39069401-39069423 GCTTTTAAGGCTAAAATTGAGGG - Intronic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1148520649 17:48271937-48271959 TCTTTTAAAAAAAACATGGAAGG + Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149103482 17:52934240-52934262 TTTTTCAAGGTTAAAATGGAGGG + Intergenic
1149222673 17:54433556-54433578 TCTTTTAGGGACAACATGGCAGG - Intergenic
1150395539 17:64819007-64819029 GCTATTATGGAGAAACTGGAGGG - Intergenic
1150500155 17:65643110-65643132 GCCTTTGTGGAGAAAATGGAGGG + Intronic
1150534967 17:66027403-66027425 TCTTTAAAGGTGAGAATGTATGG + Intronic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1150885508 17:69081223-69081245 TATTTTAAGAAGAAAATTGTTGG - Intronic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1152296293 17:79469121-79469143 TCTATAGAGGAGAAAATGTAGGG + Intronic
1152449945 17:80372335-80372357 TATTTTAAGGACAAGAAGGAGGG - Intronic
1153323246 18:3793498-3793520 TCTATCAAGAAGAAATTGGAAGG - Intronic
1153578276 18:6544813-6544835 TATTTTAAGAAGAAATTTGAAGG - Intronic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155677243 18:28444315-28444337 TCTCTTACTGTGAAAATGGATGG - Intergenic
1155935826 18:31752721-31752743 TATTATAAGGAAGAAATGGAAGG + Intergenic
1155979370 18:32164661-32164683 TCTTTTGAGGTGTAAAAGGAAGG - Intronic
1156409238 18:36811892-36811914 TCTGCCAAGGAGAAAAAGGAAGG - Intronic
1156652249 18:39238290-39238312 TCTGTCAATGAGAAAATGGAGGG + Intergenic
1156864628 18:41874998-41875020 TCTTTTAAGGAAAAATAGGAAGG - Intergenic
1157308812 18:46536704-46536726 TCTTTTAACGAGAAAATTTAAGG - Intronic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157364548 18:47052075-47052097 ACTTTTCAGGAGAAAATTGTTGG + Intronic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1158277202 18:55781062-55781084 TCTTGAAAGCAGTAAATGGAGGG + Intergenic
1158507005 18:58055671-58055693 TATTTTAAGGAAAAAATGACTGG + Intronic
1158742805 18:60163425-60163447 TGTGATAAGAAGAAAATGGAAGG + Intergenic
1158946327 18:62450124-62450146 TTTTTAAAGGAAAAAATGAAGGG + Intergenic
1159346003 18:67205047-67205069 ATTTTAAAGGATAAAATGGAAGG - Intergenic
1159510104 18:69386899-69386921 TCATTTTAGAAGAAAAAGGATGG - Intergenic
1159568919 18:70089981-70090003 TGTTCTAAAGAGAACATGGAGGG + Intronic
1159788556 18:72746072-72746094 TATATTCAGGAGAAACTGGAGGG + Intronic
1161118560 19:2512743-2512765 TCTTTTAAGGAAAAACGGGGTGG + Exonic
1162663128 19:12186106-12186128 TGTTTTAGGGAAAAAATGGAAGG + Exonic
1163280185 19:16311549-16311571 CCTTTTAAGCAGAAACTTGAAGG - Intergenic
1163865364 19:19769401-19769423 TCTTCTAAAGAGAATATGCATGG - Intergenic
1164330194 19:24247017-24247039 ATTTTTAAGGAGAAAAAGAAAGG - Intergenic
1164567880 19:29341056-29341078 GATTTTAAGGAGAAAATGAAGGG - Intergenic
1167803714 19:51764152-51764174 TGTTTTTGGCAGAAAATGGAAGG + Intronic
1167943447 19:52966058-52966080 TCTTTTAGGAATAAAATGGGAGG + Intergenic
1167996993 19:53413893-53413915 TTGTTTAAGAATAAAATGGAAGG - Intronic
1168336096 19:55598711-55598733 TCTTTAAAGGAAAAATTGGGTGG - Intronic
924992927 2:329384-329406 ACATTTTGGGAGAAAATGGAGGG + Intergenic
925491754 2:4402817-4402839 TTTATTAAGGAGAAAATTGATGG + Intergenic
926585370 2:14680136-14680158 TTTTATACAGAGAAAATGGAGGG + Intergenic
926885019 2:17589146-17589168 TCTGTTGAGCAGAAAATGGGGGG + Intronic
926900450 2:17746054-17746076 ATTTTTAAGGTAAAAATGGATGG - Intronic
926956311 2:18304963-18304985 TCATTTAATGAGAAATTGAATGG - Intronic
927313493 2:21655873-21655895 TCTTTTTAGAAGAAAATTGAAGG + Intergenic
927327516 2:21822359-21822381 TCCTTTAAGGAGAAGATACATGG - Intergenic
927410386 2:22818212-22818234 CCTTTGCAGAAGAAAATGGAAGG - Intergenic
928604288 2:32930069-32930091 TCTTGTAAGAAGAATATGGTTGG + Intergenic
928613985 2:33018239-33018261 TGTTTTAAGGAAGACATGGATGG - Intronic
929115313 2:38438914-38438936 TTTTTTAAGGAGACACTGCAAGG - Intergenic
929403485 2:41612702-41612724 TTTATTAAGGAGCAAAAGGAAGG + Intergenic
929860059 2:45669219-45669241 TATTTTAAGGGGAAAAGGGGAGG + Intronic
930105148 2:47633443-47633465 TCTTTTAAGTGGGAAATGGGAGG + Intergenic
930158823 2:48132308-48132330 TCTTTTAAGAAGAAAAGAAAAGG - Intergenic
930373957 2:50540570-50540592 TCTTTTAATGACAAAAGGAAAGG + Intronic
931295568 2:60921362-60921384 CACTTTTAGGAGAAAATGGAAGG - Intronic
931858274 2:66327097-66327119 TGTGTTAAGGAGAGAATGGTGGG + Intergenic
932312280 2:70753385-70753407 TCTTTCAAGGAGAACATAAAGGG + Intronic
932499970 2:72174608-72174630 TCTTTCCAGAAAAAAATGGATGG + Intergenic
933916583 2:87000637-87000659 TCTCTTAAAGAGAAAATGTAAGG - Intronic
934006411 2:87769277-87769299 TCTCTTAAAGAGAAAATGTAAGG + Intronic
935253059 2:101282562-101282584 TCTTTAAAGCAGCAAATGGAAGG - Intronic
935577767 2:104728669-104728691 TCTTATGAGGAGAATATGGACGG - Intergenic
935770063 2:106410185-106410207 TCTCTTAAAGAGAAAATGTAAGG + Intronic
935910032 2:107885739-107885761 TCTCTTAAAGAGAGAATGTAAGG - Intronic
936131816 2:109850869-109850891 TCTCTTAAAGAGAGAATGTAAGG - Intronic
936212881 2:110520616-110520638 TCTCTTAAAGAGAGAATGTAAGG + Intronic
936422021 2:112375172-112375194 TCTCTTAAAGAGAGAATGTAAGG + Intronic
937393404 2:121513439-121513461 TTTTTTAAAGAGAAGAAGGAGGG + Intronic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
937926697 2:127173355-127173377 TCTTTTAAGAAAAGAATGGAAGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938550118 2:132372485-132372507 TCTTTTAAGAAGAACATGCAGGG - Intergenic
939720388 2:145643013-145643035 TCTTTGTAGGACAAAAGGGATGG + Intergenic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
940084292 2:149840343-149840365 TCTCTTAAAGAAAAAATGGAAGG + Intergenic
940528818 2:154852526-154852548 GCTTTTAGGGAGAAAATATAAGG + Intronic
941377829 2:164752857-164752879 TTTGTAAATGAGAAAATGGAAGG - Intronic
941739375 2:169016631-169016653 TATTTTAAAGAGAAAAAGAATGG + Intronic
941929649 2:170927230-170927252 TTTTTTAAGTGGAAAATGTAAGG + Intergenic
941976891 2:171415317-171415339 TATATTAAGAAGAAAATGCAAGG - Intronic
941994779 2:171592051-171592073 TATTTTTAGGAGAAAATGGATGG + Intergenic
942499458 2:176573596-176573618 TCTATTAATGAAAAAATGTAAGG - Intergenic
942593435 2:177569608-177569630 TTTTCTCAGGAGAAAATGAAAGG - Intergenic
942641845 2:178068904-178068926 CATTTTAAGTAGAGAATGGAAGG + Intronic
943049545 2:182898675-182898697 AATTTTCAGGAGAAAATGTAGGG + Intergenic
943948578 2:194099341-194099363 GGTCTTCAGGAGAAAATGGAGGG - Intergenic
944641929 2:201736164-201736186 TCTTATAAGCAGCACATGGATGG - Intronic
945012294 2:205478324-205478346 TATTTTCAGGAGAAACTGGTTGG - Intronic
945259724 2:207832309-207832331 TCCTTTAAAGAGAAAAGGGTTGG - Intronic
945554236 2:211259486-211259508 TTATGTAAGGAAAAAATGGAGGG + Intergenic
945735674 2:213596885-213596907 TCTTGCAAGGAGAAAATATAGGG + Intronic
945743860 2:213696783-213696805 TCATTTGAGGAGAGAATGGGAGG + Intronic
945773405 2:214074449-214074471 TTTTTAAAGAAGATAATGGAAGG + Intronic
945987550 2:216367418-216367440 TCTATGAAGGAGACAAAGGAGGG - Intronic
946538627 2:220659114-220659136 TATTTAAAGGAGAACAAGGAAGG - Intergenic
946895918 2:224323505-224323527 TGTTTTGGTGAGAAAATGGAGGG + Intergenic
947094792 2:226553758-226553780 TCTGTTAAGAAGTAAACGGAAGG - Intergenic
947368628 2:229422751-229422773 TCATTAAAGAAGAAAATGGAAGG + Intronic
947390240 2:229631426-229631448 TATTTTAAGAAGAAGCTGGAGGG - Intronic
949028872 2:241779069-241779091 GATTTTAAAGAGAAAATGGGGGG - Intronic
1169474202 20:5916304-5916326 GCTTTGAAGGAGAAAAAGAATGG - Exonic
1169772781 20:9219646-9219668 TATTTTTAGGAGAGGATGGAGGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170415233 20:16132745-16132767 TCTTATAGGGAGAAAATTGAGGG - Intergenic
1170975988 20:21165276-21165298 GCTTTGAAGGAGAAAGAGGAGGG + Intronic
1171159755 20:22910539-22910561 TCACTTAAGGAGAGAATGGGAGG + Intergenic
1171537880 20:25913307-25913329 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1171803308 20:29648496-29648518 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1171840813 20:30208618-30208640 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1173324503 20:42020306-42020328 TTTTTTAAGTAGCAAATTGAAGG + Intergenic
1173385197 20:42581028-42581050 TGTGTGAAGGAGAAAATGGGAGG - Intronic
1174884708 20:54320768-54320790 TCTTATCAGCAGGAAATGGAGGG + Intergenic
1174903842 20:54528794-54528816 TATATAAAGAAGAAAATGGAAGG - Intronic
1175591049 20:60192413-60192435 CCTTATAAGGTCAAAATGGAGGG - Intergenic
1176581199 21:8528773-8528795 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1176665176 21:9679559-9679581 GCTTTTAAGCAGATAAAGGAAGG - Intergenic
1177112420 21:17044454-17044476 TCTTTTAAGGAGAAAACTAAAGG - Intergenic
1177229288 21:18298773-18298795 TCTTTTAAAGAGGCAATGGGTGG - Intronic
1177603022 21:23339801-23339823 TGTTCTGAGGATAAAATGGAAGG - Intergenic
1177766507 21:25463818-25463840 TTTTTTAAGTAGTAAATAGAAGG + Intergenic
1177770915 21:25514571-25514593 ACTTTTAAGGAGAATATACATGG - Intergenic
1178423059 21:32457403-32457425 TCTTTTCAGGAGAAAGAGCAGGG + Intronic
1179407727 21:41139160-41139182 TCTGTAAATGAGAAAATGGAGGG + Intergenic
1179407798 21:41139863-41139885 TCTGTAAATGAGAAAATGTAGGG - Intergenic
1179723290 21:43327851-43327873 TATTTTAAGGATAAAAAGAATGG - Intergenic
1180467911 22:15632894-15632916 TCTTTTAAAGAAGAAAAGGAAGG - Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182382240 22:29901201-29901223 TCATTTTAGGAGAAAATTAAGGG - Intronic
1183114330 22:35678276-35678298 GCTTGTAAGGAGCAAATGTATGG - Intergenic
949758794 3:7445124-7445146 TCCTGCAAGGAGGAAATGGATGG - Intronic
949839727 3:8306726-8306748 TCATTCCAGGAGAACATGGAAGG + Intergenic
950167009 3:10808817-10808839 TGATTTAAGTAGAAAATAGATGG - Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
952809770 3:37391414-37391436 TCTTTTAAGAAGAAAGGAGAAGG + Intronic
952991088 3:38831464-38831486 TCTTTTAATAAGAAAAAGGGGGG + Intergenic
953348959 3:42200231-42200253 CCTTTTAAAGAGAAAAGGGTAGG - Intronic
953361383 3:42300339-42300361 TCTTTTGGGGAGAAAATTGGAGG + Intergenic
955041123 3:55318869-55318891 TAAATTAGGGAGAAAATGGAGGG - Intergenic
955499420 3:59569548-59569570 TCCTTTAAGAAGACAAAGGATGG + Intergenic
955793168 3:62608951-62608973 ACCTTTTAGGAGAAAATGCATGG - Intronic
955829883 3:62989930-62989952 TGTTTTGAGGAGAAAAGGAACGG - Intergenic
956347106 3:68292526-68292548 TCTTTTAAAAAGAAAAAGAAAGG - Intronic
956752977 3:72359611-72359633 TATTTTAAGCTGAAAATAGATGG + Intergenic
957005489 3:74941124-74941146 TATTTGAAGGAGAATATGGTAGG + Intergenic
957564571 3:81867154-81867176 TTTTTAAAGAAGAAAATGGGAGG + Intergenic
957588060 3:82158267-82158289 TTTTTTAAGGAAAATTTGGAGGG - Intergenic
958010097 3:87866070-87866092 TCTTTTAGAGAGAAAATGTCTGG - Intergenic
958138825 3:89533668-89533690 TTTTTTGAGGAGAAAAGGCAGGG + Intergenic
958425937 3:93978836-93978858 TTATTTAAGTAGAAAATGAATGG + Intergenic
958643103 3:96834307-96834329 TATTTTAATGAGAAAAGGCATGG - Intronic
958798075 3:98727804-98727826 TCTTCTAAGGAGAAAAGTTAAGG + Intergenic
959121481 3:102237972-102237994 TCTTTTGAAAAGAAAATGTAAGG + Intronic
959174519 3:102889685-102889707 ACTTTTTAGGTGAAAATGGAGGG + Intergenic
959449827 3:106485442-106485464 GCTTTTAATGAGAAAAAGGAAGG - Intergenic
960382634 3:116983071-116983093 ACTTTTGAGGAGAAAAAGGGAGG + Intronic
960521628 3:118661995-118662017 TCTTCAAAAGAGAAAATAGAAGG - Intergenic
961839121 3:129693694-129693716 TAGTTTAAGGAGAAAGTGAAAGG - Intronic
962147920 3:132860506-132860528 TCTTTTAAGGAGAGATAGGTAGG - Intergenic
962391711 3:134977900-134977922 CCTGTGAAGGAGAGAATGGAAGG + Intronic
963279583 3:143369666-143369688 TCTTTGAAGGAAAAAAAAGATGG + Intronic
963597456 3:147346381-147346403 TCATTTATAAAGAAAATGGAAGG - Intergenic
963967572 3:151389839-151389861 TTTATAAAGGAGAAGATGGAAGG - Intronic
964176514 3:153829812-153829834 TATTTTACGGAGAACATTGAAGG + Intergenic
964490236 3:157228278-157228300 TGAGTTAAAGAGAAAATGGAAGG - Intergenic
964614690 3:158650115-158650137 TCTTGTAAGCAGGAAAAGGATGG + Intronic
964822341 3:160785797-160785819 TCTTGTAAGAACAAAATGAAGGG - Intronic
965166624 3:165202188-165202210 TATTTTAAGGTGAAAGTGGGAGG - Intergenic
965186295 3:165468627-165468649 TCTGCAAAGGAGAAAAAGGAAGG - Intergenic
965386577 3:168053739-168053761 TCTTTTATGGAGGAATGGGATGG - Intronic
965860955 3:173149606-173149628 TTTTTTAAGGAAATAATGAAGGG - Intergenic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
966692971 3:182760481-182760503 TATTTTAAGGATAAAATGAGGGG - Intergenic
967081263 3:186051970-186051992 TCTTTTAAGGAAAAAGTCCAGGG - Intronic
967086862 3:186103100-186103122 TCTTTTAAGGATAAAAGAGATGG - Intronic
967368560 3:188716367-188716389 TCAATTAAGATGAAAATGGAGGG + Intronic
967516290 3:190372749-190372771 TCCTTTAAGGAGAGGATTGAAGG - Intronic
968026361 3:195445841-195445863 TGTTTTAAAGAGAAGATGAAAGG - Intergenic
968073242 3:195801354-195801376 TCAGTGAAGTAGAAAATGGAGGG - Intronic
969401030 4:6955618-6955640 TCTGTTAATGAGACAAAGGAGGG + Intronic
969901171 4:10351098-10351120 TCTTATATGGAGAAAATTTAAGG - Intergenic
970125047 4:12799766-12799788 ACTCTAAAGGAGAAACTGGAAGG - Intergenic
970771141 4:19614241-19614263 TCTTTTATGTATAAAAGGGAAGG - Intergenic
970820103 4:20202082-20202104 TCTTTGAAAGACAAAAAGGAAGG - Intergenic
971129185 4:23787169-23787191 TTTATTGAGGAGGAAATGGAGGG - Intronic
971151159 4:24032962-24032984 TATTTTAAGGAGAAAATCCTAGG + Intergenic
971410079 4:26361101-26361123 TGTTTTAAGGAGGAATGGGAAGG + Intronic
972024314 4:34358065-34358087 GCTCTAAAGGAGAAAAGGGAAGG + Intergenic
972300241 4:37778709-37778731 TATTTTAAGGAGAAAAGGGGAGG - Intergenic
972509498 4:39754229-39754251 TCCTTTAATGAGAAGGTGGATGG + Intronic
972512489 4:39782573-39782595 TCCTGTAAGGGGAAAATGGGTGG + Exonic
972690694 4:41395043-41395065 TCTCTTAAAAAGAAAAAGGAGGG + Intronic
972912566 4:43836114-43836136 TCTATTAAGAAGCAAATGCAGGG + Intergenic
973028582 4:45306096-45306118 TATTGTAAGGAGAAGATTGAAGG + Intergenic
973046946 4:45545859-45545881 TCTTTTGGGGAAAACATGGATGG + Intergenic
973656529 4:53053781-53053803 TTTTTTAAAAAGAAAATAGAAGG - Intronic
973710115 4:53621488-53621510 TCATTTAATGAAACAATGGATGG + Intronic
973749882 4:54004434-54004456 TCTTTTGAGAAGATAATGGGAGG - Intronic
975233461 4:71962598-71962620 TCATTCAGGAAGAAAATGGAAGG + Intergenic
975533851 4:75428138-75428160 TGATGTAAGGAGCAAATGGAAGG + Intergenic
975850987 4:78572494-78572516 TTTTTCAAGGTTAAAATGGAGGG + Intronic
976145367 4:82037683-82037705 CATTTTAAGGAGAGAAGGGATGG + Intronic
976586955 4:86809304-86809326 TCTATTAAGAAAAACATGGAAGG - Intronic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
976831281 4:89317630-89317652 TGTTTTAAAGAGAAGAGGGATGG + Intergenic
976842089 4:89443839-89443861 TGTTTAAAGGAGAATATGTATGG - Intergenic
977597572 4:98900524-98900546 TCTTTTAAGTAGAGAGTGAATGG + Intronic
978197593 4:105989368-105989390 TCATTTAAGGAGAAAATTTACGG - Intronic
978684120 4:111418037-111418059 TATTTTAATAAGAAAATGAAAGG - Intergenic
979574525 4:122272384-122272406 ACTCTTAAGGAAAAAATGAAAGG + Exonic
979776884 4:124600497-124600519 TCATTTAAAGAGAAGATTGAAGG + Intergenic
980771074 4:137373999-137374021 GATTTTAAGGAAATAATGGAGGG + Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981930045 4:150179987-150180009 ACTTTTATGGAGTAAATGAATGG - Intronic
982635027 4:157884878-157884900 TTTTTAAAAGAGTAAATGGATGG + Intergenic
982767356 4:159364401-159364423 TCTTTTGATGAGACAATGGTAGG + Intergenic
982844160 4:160228871-160228893 TCTCTTTAGGAGAAAAAGAAAGG - Intergenic
985426058 4:189831773-189831795 TCTTTTAAAGAAAAATAGGAAGG + Intergenic
986551401 5:8959932-8959954 TCTTTTAAGAAGGAACTGTATGG - Intergenic
986871044 5:12047297-12047319 TCTTTTAAAAAGAATATTGAAGG - Intergenic
986900567 5:12427181-12427203 TCTTTCAGGTAGAAAATTGAAGG - Intergenic
987185916 5:15419025-15419047 ACTTGTAAGAAGAAAATGAAAGG - Intergenic
988321146 5:29698309-29698331 GGTTGTAAGGAGAAAAGGGAGGG - Intergenic
988809378 5:34769302-34769324 TCTTTTCAGCAGAAAAGTGATGG - Intronic
988962351 5:36382897-36382919 TCTATTAAGAAGAAAAAAGAAGG - Intergenic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
990422736 5:55652858-55652880 TCTTTTCTGGAAAAAATAGAGGG + Intronic
990797325 5:59558620-59558642 TATTTTAAAGAGAAAACTGAAGG + Intronic
990916097 5:60907227-60907249 TATTTCAAGGAGAAAATAGGAGG + Intronic
991088162 5:62667429-62667451 TCTTGTAATCAGAAAATGAAAGG + Intergenic
991194446 5:63916373-63916395 TTTTTAAAAGAGCAAATGGAAGG - Intergenic
991271279 5:64784867-64784889 ATTTTTAAGGAATAAATGGAGGG - Intronic
991453015 5:66772688-66772710 TGTTTTAGGGTGTAAATGGAAGG + Intronic
991986499 5:72292437-72292459 TCTTTTAAGGAGAGATAGAAAGG - Intronic
992387756 5:76302006-76302028 TCTTTTAAAAAGAAAATATAGGG + Intronic
992541296 5:77766961-77766983 TCTTTTCAGGACCAAAGGGATGG - Intronic
995043893 5:107621879-107621901 TTTTTTAAGGTGAAAAGAGATGG + Intronic
995797627 5:115958519-115958541 GCTTTTAAGGAGAATTTGGTGGG - Intergenic
995868686 5:116721697-116721719 TGATTAAATGAGAAAATGGAAGG + Intergenic
996303864 5:122023510-122023532 TAGCTTAAGGAAAAAATGGAAGG + Intronic
996440713 5:123487126-123487148 TCTTTTAAGGAAAAAAAAAACGG - Intergenic
996614072 5:125418904-125418926 TCTATTAAGAAGAAAATTGGGGG + Intergenic
997138935 5:131357944-131357966 TGTTTCAAGGAGAAAGTGGGTGG - Intronic
997407860 5:133666267-133666289 TGTTTTAATTAGAAAATTGATGG + Intergenic
998365555 5:141628502-141628524 TATTTCAAGGAGAAAAAGAAGGG + Intronic
998431105 5:142070741-142070763 TCCTTGAAGCAGAGAATGGAAGG - Intergenic
998979430 5:147685026-147685048 TGTTTTAAGTATGAAATGGAAGG - Intronic
999019744 5:148151907-148151929 TCTCTTAAGGAGAATATCTATGG + Intergenic
999408100 5:151324996-151325018 TCTACTAAGGAGAGAAGGGAAGG - Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000140248 5:158396388-158396410 TGTTCCAAGGAGAAAATGCAGGG - Intergenic
1001585152 5:172828987-172829009 TGTTTTAAGCAGAGAATGGCTGG - Intergenic
1002207478 5:177573489-177573511 TCTTTTAGGTAGAAAGTGGGAGG + Intergenic
1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG + Intergenic
1003466138 6:6381941-6381963 TGTTTTAAGGAGATAAAAGAAGG + Intergenic
1004223016 6:13762714-13762736 TCTTTTGAGCATAAAATGGAGGG + Intergenic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1005585866 6:27275938-27275960 TATTTTTAGGAGACAATGGCTGG - Intergenic
1006108598 6:31730795-31730817 GCCTTTGTGGAGAAAATGGAGGG + Exonic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006724948 6:36192146-36192168 TCTGTTTAGGAGAAGAGGGAAGG - Intergenic
1008366036 6:50681745-50681767 TCTTTTTAGAAGAAAATAGGAGG - Intergenic
1009328667 6:62386549-62386571 AATTTTAAGGAGCAAATTGAAGG - Intergenic
1010051586 6:71510741-71510763 TCTGTTAAAAAGGAAATGGAGGG + Intergenic
1010178913 6:73062027-73062049 TATTTTAAGAGGTAAATGGAAGG + Intronic
1010455360 6:76048556-76048578 TCTTGAAAGGTGAAAAAGGATGG - Intronic
1010722548 6:79300242-79300264 CCTTTTAGGTAGAAAAGGGATGG + Intergenic
1010804496 6:80219121-80219143 TTTTTCAAAGAGAAAATGAAAGG - Intronic
1010923623 6:81716189-81716211 TCTGTTAAATGGAAAATGGATGG + Intronic
1010933951 6:81837756-81837778 TCTTGTAAGTAGAAAATGGTTGG + Intergenic
1011052073 6:83163136-83163158 TTTTTAAAGAAGAAAAAGGAAGG + Intronic
1011055061 6:83194978-83195000 TCTTTTAAGGAGTGAATGAGTGG + Intronic
1011135225 6:84092875-84092897 TCCAAAAAGGAGAAAATGGAAGG + Intergenic
1011239880 6:85259664-85259686 TTTTTTAAAGAGAAACTGGTTGG - Intergenic
1011394338 6:86890852-86890874 TCTTTTAAGAAGGAAAAGTAAGG - Intergenic
1011528442 6:88292897-88292919 CCTTTTAAGGATAAGAAGGAAGG - Intergenic
1011824637 6:91291634-91291656 TCATTTCAGGAGAAAAATGAAGG + Intergenic
1012030581 6:94056018-94056040 TTTTCTAAGTAGAAAATGTATGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012641585 6:101624537-101624559 TATTTTATGGAGAAAACTGAGGG + Intronic
1012868496 6:104645745-104645767 TCTGTAAAGGAGAAACTAGAGGG - Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1013542834 6:111128091-111128113 TGTTTTAAGAAGAAAATTCAAGG - Intronic
1013592448 6:111630880-111630902 TATCTGAAGGGGAAAATGGAGGG - Intergenic
1013643244 6:112108781-112108803 TCTTTTAAGGAGATAAGGAAGGG + Exonic
1014919427 6:127195814-127195836 TCATTTCAGGAAAAAAAGGAAGG + Exonic
1015117066 6:129661491-129661513 TCATTTAAAGAGAAAAAGGGTGG - Intronic
1015431813 6:133140473-133140495 AGTTTTAAGGAGAAATTGCAAGG + Intergenic
1016181018 6:141148645-141148667 CCTTTTAATAAGAAAATGCAGGG + Intergenic
1016864371 6:148750583-148750605 AGTTTAAGGGAGAAAATGGAAGG + Intronic
1017150741 6:151277414-151277436 TTTTTTAAGTGCAAAATGGATGG + Intronic
1017527041 6:155250449-155250471 TAGTTTAGGGAGAAAATGGCAGG + Intronic
1018567880 6:165175555-165175577 TCTTTTAAGGAAATATTGAAGGG + Intergenic
1018698748 6:166411009-166411031 TCTTCTATGGAGAAAATGTGAGG + Intronic
1019018223 6:168896090-168896112 TCATTTAGGGAGTAAAGGGATGG - Intergenic
1019953730 7:4395059-4395081 TCTTTCAAGGAGAGCATGTAGGG + Intergenic
1020502086 7:8936151-8936173 TCTCTGAAGGAGAGAATAGAAGG + Intergenic
1021837449 7:24693996-24694018 TCTTTAAAAAAAAAAATGGAGGG + Exonic
1021906938 7:25343700-25343722 TCTTTAAAGGAGAAAATGTCAGG + Intergenic
1022034328 7:26519342-26519364 GCTTTTAAGAAGAAGTTGGAGGG - Intergenic
1022188783 7:27996890-27996912 TTTTATAATGAGAAAATTGAAGG + Intronic
1022330351 7:29373071-29373093 TTTTTTAATGCAAAAATGGATGG + Intronic
1022484628 7:30768972-30768994 TTTTTAAAGGAGTAAATGAATGG + Intronic
1022662749 7:32381749-32381771 TCTTTCAAGGATAATATGTAAGG - Intergenic
1023187310 7:37545643-37545665 TTTTTAAAGGAGACACTGGAAGG + Intergenic
1023950758 7:44842635-44842657 AATTTGAAGTAGAAAATGGAAGG - Intronic
1023954480 7:44873248-44873270 TCTTGTAAGGAGCAAATGTCTGG + Intergenic
1024199864 7:47095696-47095718 TCCTTTAAGGATATAATGTACGG + Intergenic
1024745739 7:52404002-52404024 TTTTTAAAGGGGAAAATAGAGGG + Intergenic
1025289331 7:57700136-57700158 TGTTTTAAGAAATAAATGGAGGG - Intergenic
1026279244 7:68906833-68906855 TCTTTCAAGGGGAAAATGGATGG - Intergenic
1027386697 7:77666065-77666087 TCTGGTAAGAAGAAAATGAAGGG + Intergenic
1027565996 7:79795437-79795459 TCTTTTAAGGCAAAAAAAGAAGG + Intergenic
1027604619 7:80285360-80285382 TCTTTTAGAGAGAAAAAGTAAGG - Intergenic
1027662922 7:81008998-81009020 TCTTTGCAGTAGGAAATGGATGG + Intergenic
1028814079 7:95124025-95124047 TCTATTAATAAGAAAATTGAGGG + Intronic
1029870468 7:103686244-103686266 TCCTTAATGGAGGAAATGGATGG - Intronic
1029927676 7:104334814-104334836 TTTTTTAATGAGAAAATAAATGG - Intronic
1030084859 7:105807386-105807408 TCTTTCAAGGAAGAAATGAAAGG - Intronic
1030189202 7:106793965-106793987 TATTTTAAAGGGAAAATGGTGGG + Intergenic
1031111734 7:117618675-117618697 TATTTTAAGGAGATACTGAACGG - Intronic
1031982656 7:128137565-128137587 TCATTTGAGCAGAAACTGGAAGG - Intergenic
1032634438 7:133691008-133691030 GCTTTTAAGCAGATAAGGGAGGG + Intronic
1032885036 7:136128375-136128397 CCTTTGAAGGAGTGAATGGAAGG + Intergenic
1033030352 7:137820347-137820369 TCTGATGAAGAGAAAATGGAGGG - Intronic
1033153286 7:138935053-138935075 TCTTTAGAGGAGGAAATGGAAGG - Intronic
1033352479 7:140572890-140572912 TGTTTTAAGAAGAAAAGGGAAGG - Intronic
1034048056 7:147950755-147950777 GCTTTTAGGAAGAAAAAGGAAGG - Intronic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037391781 8:18400442-18400464 TCTGTCAAGCAGAAAATGCAAGG - Exonic
1037622452 8:20576685-20576707 TCGTTACAGGAGAAAATAGAAGG - Intergenic
1037894898 8:22645478-22645500 TCTTTTAAAGAGATAAAGGAAGG + Intronic
1037907140 8:22722165-22722187 TTTTTAAGTGAGAAAATGGAGGG - Intronic
1039927996 8:41956414-41956436 TCTTTAAAGCATAAAATTGAAGG - Intronic
1040045495 8:42959420-42959442 TTTTTTAGGGAAAAAATGGCTGG + Intronic
1040450330 8:47539731-47539753 TTTTTTAAGAAGAAAAGTGAAGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041344489 8:56882555-56882577 ACTTTTAAGGGGAAAATCAAAGG + Intergenic
1042452183 8:68960524-68960546 TCTTTTAGGGAGAAAGGAGAGGG - Intergenic
1042909431 8:73810222-73810244 TCTTTTAAACAGGAAATGTACGG - Intronic
1043064824 8:75555453-75555475 TCTTGTAAGGAAAAGATGGGAGG - Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043697952 8:83245125-83245147 TCTTCTAAAGAATAAATGGATGG + Intergenic
1043836167 8:85049471-85049493 TCTTTTTAGGAGTATCTGGAAGG - Intergenic
1043850153 8:85206693-85206715 TATTTTAAGGAGAAAACACAGGG - Intronic
1045531619 8:102990402-102990424 TCTTTTAAGGAGGTTTTGGAGGG + Intergenic
1045540470 8:103079578-103079600 TCTTTGCAGGAAAAAATGGCAGG - Intergenic
1046225391 8:111272162-111272184 TCTTCTTAAGAGAAAGTGGAAGG - Intergenic
1046350354 8:113001586-113001608 GCTATAAAGGAAAAAATGGAAGG - Intronic
1046541135 8:115585437-115585459 AATTTTAAGTAGAAAAAGGAAGG + Intronic
1046561909 8:115848512-115848534 TTAATTAAAGAGAAAATGGAAGG - Intergenic
1047648837 8:126898399-126898421 TGATTTTAGGAGAAAAGGGAAGG - Intergenic
1048129857 8:131683694-131683716 ACTTTTAAGGAAAAAGTGAAAGG + Intergenic
1048212270 8:132465172-132465194 TCTTTTGTGGAGAAAATGGCAGG - Intronic
1051541691 9:18227105-18227127 TTTTGTTAGGAAAAAATGGAGGG - Intergenic
1052042471 9:23754828-23754850 GCTTTTAGGGAGAAAAGGGGAGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052537110 9:29761434-29761456 GCTTTTAGGGAGAAAATGGTGGG + Intergenic
1052969612 9:34369385-34369407 TCTTAGAAAGAGAAAATGGCTGG + Exonic
1053566948 9:39262927-39262949 GTTTATAAGGAAAAAATGGAAGG - Intronic
1053832723 9:42100769-42100791 GTTTATAAGGAAAAAATGGAAGG - Intronic
1054130195 9:61356080-61356102 GTTTATAAGGAAAAAATGGAAGG + Intergenic
1054597830 9:67086641-67086663 GTTTATAAGGAAAAAATGGAAGG + Intergenic
1054799978 9:69337731-69337753 ACTTTTAATGATAAAATAGAGGG + Intronic
1055628550 9:78199445-78199467 TCTTTTCAGAAAAACATGGATGG + Intergenic
1055715681 9:79115370-79115392 TCTTCTGAGCAGTAAATGGAAGG + Intergenic
1055922116 9:81472036-81472058 TATTTTAAGTAGAGACTGGAGGG - Intergenic
1056316694 9:85397153-85397175 TCTCTCAAGGAGAAAATGGACGG + Intergenic
1059044624 9:110853011-110853033 TATTTTGATGAGAAAATGGAGGG - Intergenic
1059561122 9:115335435-115335457 TCTTTTCAGGAGAAATAGCATGG + Intronic
1059622214 9:116019288-116019310 TGTGTTCAAGAGAAAATGGAAGG - Intergenic
1060472576 9:123960854-123960876 TTTGTGAAGGAAAAAATGGAAGG + Intergenic
1061232507 9:129322871-129322893 TCTGATAAGGATAAAAAGGAGGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1203611218 Un_KI270749v1:6818-6840 TGTTTTAAGAAATAAATGGAGGG + Intergenic
1203660924 Un_KI270753v1:42190-42212 GCTTTTAAGCAGATAAAGGAAGG + Intergenic
1185815422 X:3150690-3150712 GCTTTTAAGCAGAAAGTGGGAGG - Intergenic
1186213752 X:7277395-7277417 TGTTTAAAGCAGAAAATTGATGG + Intronic
1186746466 X:12575007-12575029 TCTTTTAACGAGTTCATGGAAGG - Intronic
1186751653 X:12627857-12627879 TTTATTAAGAAAAAAATGGAAGG + Intronic
1186859823 X:13661323-13661345 TCTTCTAAGGAGAAATTAGAAGG - Intronic
1186951884 X:14635626-14635648 ACTATTCAGGAGAAAATGGACGG + Intronic
1187303632 X:18075277-18075299 TCTTTTATGGGGAAAATGAAAGG + Intergenic
1188710241 X:33387885-33387907 TCTTGTAAGAAAAAAAAGGAGGG + Intergenic
1188867847 X:35336209-35336231 TCTATTACTTAGAAAATGGAGGG + Intergenic
1189000796 X:36942575-36942597 TCTTCTAAGAAGAAAAGGGAAGG - Intergenic
1190121725 X:47665843-47665865 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190125626 X:47702875-47702897 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190757623 X:53414543-53414565 TGTTTTAAGGAAAAAAGGGAGGG + Intronic
1191123137 X:56926521-56926543 TCTTGTCAGGAGAAACGGGATGG + Intergenic
1193364620 X:80617054-80617076 CCATTAAATGAGAAAATGGAGGG - Intergenic
1193708086 X:84847151-84847173 TCCTTTAAGGGGAAACTGGGTGG + Intergenic
1193711148 X:84881849-84881871 TCCTGTAAGGGGAAAATGGGTGG - Intergenic
1193729475 X:85085614-85085636 TCTTTTATGCAGAAAAGGTATGG + Intronic
1195024363 X:100861444-100861466 TATATTGAGGAGTAAATGGAAGG - Intronic
1195591108 X:106628152-106628174 TCTTTTAAAGAGAAAAAAAAAGG + Intronic
1196041173 X:111205970-111205992 TGTGTTAAAGAGAAAATGGGAGG + Intronic
1197691441 X:129505014-129505036 TCTTTTAAGGAAAAAGTTGATGG - Intronic
1197840529 X:130741410-130741432 TCTTAGAGGGAGAAAATGAAAGG - Intronic
1198389971 X:136163875-136163897 TCTTTTAAGGAAAGAATGCTTGG + Intronic
1199029480 X:142979989-142980011 TATTTTATTGAGAAAATAGAAGG + Intergenic
1199251886 X:145673064-145673086 TCTTTTTACGAGAAAATGACTGG + Intergenic
1201939975 Y:19448903-19448925 TCTCTTAAGGAAAAGATGGCTGG - Intergenic