ID: 981575531

View in Genome Browser
Species Human (GRCh38)
Location 4:146200605-146200627
Sequence CACTGCACAAAGCAACTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981575528_981575531 14 Left 981575528 4:146200568-146200590 CCTCTAAGTTAACTCTCCAGGGG No data
Right 981575531 4:146200605-146200627 CACTGCACAAAGCAACTTGCAGG No data
981575530_981575531 -2 Left 981575530 4:146200584-146200606 CCAGGGGCACTGATGATATCACA No data
Right 981575531 4:146200605-146200627 CACTGCACAAAGCAACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981575531 Original CRISPR CACTGCACAAAGCAACTTGC AGG Intergenic
No off target data available for this crispr