ID: 981576725

View in Genome Browser
Species Human (GRCh38)
Location 4:146213414-146213436
Sequence CTGTGTCAGGACCCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981576721_981576725 -5 Left 981576721 4:146213396-146213418 CCTGCTAGGGGCAGAGATCTGTG No data
Right 981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG No data
981576720_981576725 2 Left 981576720 4:146213389-146213411 CCACTCTCCTGCTAGGGGCAGAG No data
Right 981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981576725 Original CRISPR CTGTGTCAGGACCCAGTGGA GGG Intergenic
No off target data available for this crispr