ID: 981579028

View in Genome Browser
Species Human (GRCh38)
Location 4:146233739-146233761
Sequence GGCCTTCAAGTGACTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981579028_981579031 -7 Left 981579028 4:146233739-146233761 CCTGGCCCAGTCACTTGAAGGCC No data
Right 981579031 4:146233755-146233777 GAAGGCCACACGAGTTGTCATGG No data
981579028_981579033 3 Left 981579028 4:146233739-146233761 CCTGGCCCAGTCACTTGAAGGCC No data
Right 981579033 4:146233765-146233787 CGAGTTGTCATGGTAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981579028 Original CRISPR GGCCTTCAAGTGACTGGGCC AGG (reversed) Intergenic
No off target data available for this crispr