ID: 981581866

View in Genome Browser
Species Human (GRCh38)
Location 4:146257507-146257529
Sequence TAGGGTAGTTCAGCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981581866 Original CRISPR TAGGGTAGTTCAGCCAGTGC TGG (reversed) Intronic
904573927 1:31489816-31489838 TAAGTTAGTTCAACCATTGCGGG - Intergenic
906310844 1:44753155-44753177 AATGGTATTTCAGCCACTGCAGG - Exonic
911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG + Intronic
915868986 1:159537874-159537896 TATGGTAGTGCTGCAAGTGCAGG + Intergenic
920550438 1:206856175-206856197 TTGGGAAGTTAAGCCTGTGCTGG - Intergenic
1063182899 10:3622049-3622071 TTGGGAAGAGCAGCCAGTGCAGG + Intergenic
1063886829 10:10588355-10588377 TAGGGTCTCTCAGCCAGTGTGGG - Intergenic
1065768644 10:29055959-29055981 AAGGGTTGATCAGGCAGTGCTGG + Intergenic
1067776963 10:49170902-49170924 CAGGGGACATCAGCCAGTGCTGG - Intronic
1067820118 10:49520984-49521006 TGGGGAAGTTCATCCAGTGCAGG - Intronic
1068196738 10:53727022-53727044 AAGGGGAGTTCAGCCAGGGGCGG - Intergenic
1073144598 10:101272311-101272333 TAGGGTACTGCAAGCAGTGCGGG + Intergenic
1074168053 10:110903556-110903578 AAGTGTAGCCCAGCCAGTGCTGG - Intronic
1077402980 11:2368123-2368145 TAGGGTAGCTCAGCCAGCTCTGG + Intergenic
1078506757 11:11956285-11956307 TAGGGCAGTCCAATCAGTGCTGG - Exonic
1079151669 11:17905481-17905503 AAGCCTGGTTCAGCCAGTGCTGG - Intronic
1081059986 11:38462179-38462201 AAGGGGAGTTCAGCCAGGGACGG - Intergenic
1088398060 11:109390532-109390554 AAGGGTATTTAACCCAGTGCTGG - Intergenic
1090741617 11:129667097-129667119 TGGGGAAGATGAGCCAGTGCAGG - Intergenic
1096531227 12:52244050-52244072 CAGGGCAGCTCAGCCTGTGCAGG + Intronic
1097191608 12:57222136-57222158 TAGGGGAGTTCAGACAGGGAGGG - Intronic
1097200234 12:57272293-57272315 GAGTATAGTTCAGCCTGTGCTGG + Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102650638 12:114439877-114439899 TAGGGAAGTTCAGGGAGAGCTGG - Intergenic
1103441849 12:120968879-120968901 TAGGGAAGGCCAGCCAGTGAAGG + Intergenic
1112233598 13:97613863-97613885 TAGGGTAGAGCAGTCAGTGTTGG + Intergenic
1116377215 14:44218167-44218189 TAAATTAGTTCAGCCAGTGTGGG + Intergenic
1117026624 14:51627223-51627245 TAGGGAAGTTTGGCTAGTGCAGG - Intronic
1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG + Intergenic
1138902439 16:61289506-61289528 AAGGGCAGTTCATACAGTGCCGG - Intergenic
1142363877 16:89639663-89639685 GAGAGTGGTTCTGCCAGTGCAGG - Intergenic
1146939922 17:36837270-36837292 AAGGGGAGTTGAGCCTGTGCAGG - Intergenic
1150276193 17:63899334-63899356 CAGGGTCTTTTAGCCAGTGCTGG + Intergenic
1160762308 19:791795-791817 CAGGGGAGTTCAGCTAGAGCTGG - Intergenic
1163276969 19:16290971-16290993 AGGGGTAAGTCAGCCAGTGCAGG + Intergenic
1164443601 19:28298879-28298901 TAGGGTAGCTCATCCCATGCTGG + Intergenic
1168099724 19:54134567-54134589 TGGGGTAGTTCAGCCACTCAAGG - Intergenic
925333235 2:3074864-3074886 GAGGGGAGTTCAGCCAGAGGTGG - Intergenic
926575217 2:14572584-14572606 TAGGATACAACAGCCAGTGCTGG - Intergenic
929373478 2:41255548-41255570 TAAAGTAGTTCAGCCACTGTGGG + Intergenic
929868944 2:45741732-45741754 AAGGCTAGTACAGCCTGTGCTGG + Intronic
932357626 2:71079296-71079318 TACCATAGTTCAGCCAGTGAAGG + Intronic
932370084 2:71179548-71179570 TACCATAGTTCAGCCAGTGAAGG + Intergenic
933521810 2:83383359-83383381 TAAATTAGTTCAGCCAGTGTGGG + Intergenic
933800789 2:85958848-85958870 TAGGGTGGTGCAGGCACTGCGGG - Intergenic
937888162 2:126914744-126914766 CAGGGCAGCTCATCCAGTGCAGG + Intergenic
1176220795 20:63968623-63968645 TAGGATAGTTCAGCCGGCACAGG - Intronic
1178376392 21:32071007-32071029 GAGGGCAGGTCAGCAAGTGCTGG - Intergenic
1180847388 22:18991292-18991314 TAGGGCTGCTCAGCCAGTCCTGG + Intergenic
1182049380 22:27301258-27301280 TAGGGTAAGTCAGCCAGCCCTGG - Intergenic
1184406531 22:44303840-44303862 GAGGGTGGTTCAGCCAGGCCAGG - Intronic
950446704 3:13042796-13042818 TAGGACTGTCCAGCCAGTGCCGG - Intronic
953568385 3:44052225-44052247 GAAGGAACTTCAGCCAGTGCAGG + Intergenic
954211919 3:49102571-49102593 TAGGTTTTTTCAGTCAGTGCTGG - Intronic
954488116 3:50873525-50873547 TAGGGTAGCTAAGAAAGTGCTGG - Intronic
960049478 3:113226320-113226342 TGGGGTGCTTCAGCCAGTGCTGG + Intronic
960659379 3:120041328-120041350 TATTGTAGTTGGGCCAGTGCTGG + Intronic
961199937 3:125037620-125037642 TTGGTTAGTGCAGCCACTGCTGG + Intronic
963640031 3:147849222-147849244 TATGGTAGTTTAGCCAGAGTTGG + Intergenic
966908120 3:184542468-184542490 TAGGGTAGGGCAGCCTGAGCAGG + Intronic
967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG + Intergenic
967551040 3:190796362-190796384 TAGGGAAGTCAAGCGAGTGCTGG + Intergenic
973619416 4:52712343-52712365 TCGGGTAGCTCAGCCAATCCCGG - Intergenic
977513980 4:97996995-97997017 TAAATTAGTTCAGCCATTGCTGG + Intronic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
985180252 4:187252893-187252915 TAAGTTAGTTCAGCCATTGTGGG + Intergenic
987179829 5:15355998-15356020 TAGGGTAGGTCATTCAGAGCAGG + Intergenic
988030573 5:25758284-25758306 TAGCACAGTTCAGCCAGTTCTGG - Intergenic
989349177 5:40465458-40465480 TAGGGTAGTTTAGCAATTCCAGG - Intergenic
999459550 5:151746244-151746266 TAGGTTTGTTCAGCAAGTGCTGG + Intronic
1012060507 6:94472944-94472966 TAGTTTAGTTCAGCCAGCCCAGG + Intergenic
1019774855 7:2906420-2906442 TAGGCCAGGTCAGCCAGGGCTGG + Exonic
1020940109 7:14522573-14522595 TATGGTAGTTCAACCAGGACAGG - Intronic
1024559536 7:50631695-50631717 TAGGGTAGGTCACCCAGAACAGG - Intronic
1035787511 8:2273278-2273300 TAAGCTAGTTCAGCCTGAGCTGG - Intergenic
1035805297 8:2448438-2448460 TAAGCTAGTTCAGCCTGAGCTGG + Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1045702914 8:104887235-104887257 TAGGGTAATGAAGCAAGTGCTGG + Intronic
1048970884 8:139644467-139644489 TAGGGTTTTTCAGCCAGAGGTGG + Intronic
1050535283 9:6625504-6625526 TAAGGTAATTCTTCCAGTGCAGG + Intronic
1055511202 9:76997401-76997423 TAGGGTAGTTCTGCCTGTTCTGG - Intergenic
1056899535 9:90584936-90584958 CAGTGTAGTTCAGGCAGAGCGGG - Intergenic
1057250097 9:93494108-93494130 TAGTGCAGTTCAGGCAGAGCAGG + Intronic
1057925940 9:99148992-99149014 TAGGGTACTGGTGCCAGTGCTGG - Intronic
1060557614 9:124517082-124517104 TTGGGCACTTCAGTCAGTGCTGG + Intergenic
1061874984 9:133539181-133539203 TAGGGCAGTGCAGCCAGGGTTGG + Intronic
1199655859 X:149994872-149994894 TAGGCTAGTTCAGTCAGAACTGG + Intergenic
1200468059 Y:3545941-3545963 TAGGGTGGTTAAGAGAGTGCTGG - Intergenic
1202182109 Y:22148440-22148462 GAGGGTCATTCAGCCATTGCTGG - Intergenic
1202209251 Y:22437962-22437984 GAGGGTCATTCAGCCATTGCTGG + Intergenic