ID: 981584343

View in Genome Browser
Species Human (GRCh38)
Location 4:146285069-146285091
Sequence AGACTGCAGTATGGGAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981584343 Original CRISPR AGACTGCAGTATGGGAGTGT AGG Intronic
900874832 1:5334765-5334787 AGAATTCAGGATGGGAGTGCGGG + Intergenic
901203929 1:7483387-7483409 AGACTGCAGTCTGGGAGCCTGGG + Intronic
902256112 1:15189698-15189720 AGACAGCAGCCAGGGAGTGTTGG + Intronic
904779760 1:32936922-32936944 AGGCTGCAGTATGGGAGCGGGGG + Exonic
904825049 1:33268896-33268918 TGACTGCAGTAATGGAGTGGAGG + Intronic
908620410 1:65973624-65973646 AGACTGCAGGAAGGTATTGTGGG + Intronic
909169741 1:72281050-72281072 ACACTGCAGAGTGGGAGTCTGGG - Intronic
911243970 1:95496492-95496514 AGACTGCAGTAACGCGGTGTGGG + Intergenic
913365144 1:118029186-118029208 AGGCTGGAGTATGGTAGTGTGGG - Intronic
915444287 1:155966131-155966153 ACACTGCATTTCGGGAGTGTTGG - Intronic
915759116 1:158292878-158292900 AGACTGGAGGTTGGAAGTGTAGG + Intronic
920388627 1:205585029-205585051 AGACTGGAGTCTGGGGGTGAAGG - Intronic
922525506 1:226299971-226299993 ACACTCCAGTCTGGGAGTCTGGG - Intronic
923240295 1:232078090-232078112 ACACAGCAGTATGTGAGTATGGG - Intergenic
924807183 1:247370947-247370969 AGACAGCAGTATGGGGGGGCGGG - Intergenic
1064709777 10:18111517-18111539 AGACTGCAGTATGGGGAATTGGG + Intergenic
1065240923 10:23703250-23703272 AAAGTGCAGTGTGGGAGTGGTGG + Intronic
1069176426 10:65294682-65294704 AGATTGCAATAGGGGAGTGAGGG - Intergenic
1070513328 10:77180637-77180659 ACACTGCAGTATAGGAGGGTAGG + Intronic
1074479067 10:113801963-113801985 AGAGTGCAGTTGGGGAGTGAAGG - Intergenic
1075372597 10:121950494-121950516 ACACTGCAGGAGGAGAGTGTAGG + Intergenic
1076354614 10:129842711-129842733 GGAGTGCAGTAGGGCAGTGTCGG - Intronic
1078140606 11:8689935-8689957 GGCCCGCAGTATGGCAGTGTTGG + Intronic
1078959681 11:16249766-16249788 AGACTGCAGTATATGAGAGAAGG - Intronic
1079560026 11:21810859-21810881 ACACAGCAGGATGGGAGTGCAGG + Intergenic
1079608236 11:22397056-22397078 AGACTGGAATATGGAAGTGGAGG - Intergenic
1080193854 11:29584120-29584142 AGAATGAAGGCTGGGAGTGTTGG + Intergenic
1081048167 11:38302988-38303010 AGAATGCAGTATGAGTGGGTTGG - Intergenic
1082992419 11:59219245-59219267 AGTCTTCAGGATGGGAGTGGGGG + Intergenic
1083150659 11:60789991-60790013 AGACTGCAGTTTGGAAGAGTTGG - Intronic
1084869092 11:72083869-72083891 AGACTGCAGAATTGGAGTTGAGG + Intronic
1088544771 11:110948177-110948199 AGGCCGCAGAATGGAAGTGTAGG + Intergenic
1089196023 11:116694512-116694534 GGATTGGGGTATGGGAGTGTGGG - Intergenic
1090415842 11:126539936-126539958 TTACTCCAGTCTGGGAGTGTTGG + Intronic
1091035042 11:132225225-132225247 GGGCTGCAGTATGGGAGTGTAGG + Intronic
1093180846 12:15965609-15965631 AGACTGGAGTTTGGGGGTGGGGG + Intronic
1093345672 12:18036523-18036545 ATATTGCAGCATGGGCGTGTAGG - Intergenic
1094319605 12:29170986-29171008 ATATTGCAGTATGGGCATGTGGG + Intronic
1094374727 12:29777594-29777616 AGACTACAGTCTGGTAGTGTAGG - Intronic
1095963585 12:47851475-47851497 AGACTTCTGTGTGGGTGTGTGGG - Intronic
1096084013 12:48852931-48852953 AGACTGAAGTAGGGGAATCTGGG - Intergenic
1096100098 12:48965636-48965658 AGGCTGCAGTAAAGGAGTTTGGG + Exonic
1096711813 12:53463026-53463048 ACACTGGAGTTTGGGAGTGAAGG - Intronic
1100684290 12:96969370-96969392 AGACTGGAATATGAGAGTGCAGG - Intergenic
1103557560 12:121775496-121775518 ACCCTGCAGTTTGGGAGTTTGGG + Intronic
1104767513 12:131340080-131340102 ATACTGCAGCATGGGCATGTAGG - Intergenic
1104810887 12:131619815-131619837 AGACCCCAGAGTGGGAGTGTAGG + Intergenic
1113183945 13:107664553-107664575 AGACTGAAGTTGGGGAGTGGCGG - Intronic
1113490800 13:110690175-110690197 AGAGTGCAGTAGGGCAGTGTTGG - Intronic
1116680249 14:47959200-47959222 ACTCTGCTGTATGGGAATGTTGG - Intergenic
1117049623 14:51847176-51847198 AGGCTGCAGACTGGGAGGGTGGG + Intronic
1117833693 14:59779848-59779870 AGACTGCAGGGTGGAAGTGGGGG - Intronic
1119620154 14:76125799-76125821 AGACGGCATGATGGGAGTTTGGG + Intergenic
1120011341 14:79418897-79418919 ACACTGCCGTCTGGGAATGTGGG + Intronic
1120716082 14:87842100-87842122 AGACAACAGTATGGAAATGTGGG - Intronic
1125384201 15:39119726-39119748 AGATTGCAGTATGGCAGTAGTGG - Intergenic
1127102800 15:55584529-55584551 ATACTGGAGAATGGGAGTATTGG + Intronic
1127439137 15:58988284-58988306 AGCCTACAGTGAGGGAGTGTGGG + Intronic
1128060504 15:64732514-64732536 AGCCTGGAGTGTGGGAGTCTGGG - Intergenic
1128327382 15:66733873-66733895 AAACTGCAGGATGGGAGATTTGG + Intronic
1128729840 15:70013742-70013764 AGATTGCATTCTGGGAGTGGGGG - Intergenic
1129517413 15:76165158-76165180 AGGCTGCAGGAGGGGAGAGTGGG - Intronic
1129978644 15:79846162-79846184 CAACTGCAGTAAGGGTGTGTGGG + Intronic
1131209622 15:90482875-90482897 AGTCTGCAGCATGAGAATGTTGG + Intronic
1132311900 15:100863288-100863310 AGACTGCAGTGTGCGGGGGTGGG - Intergenic
1133322522 16:4923120-4923142 AAACTGCAGAAGGGGAGGGTGGG + Intronic
1135023613 16:18982785-18982807 AGAGTGCAGTATGGAAGTGGTGG - Intergenic
1136055611 16:27687091-27687113 AGGCTACAGTCTGGGAGTGAGGG - Intronic
1137694109 16:50449709-50449731 CCACTGCAGAATGGGCGTGTGGG - Intergenic
1137706838 16:50541298-50541320 AGACCACAGTTTGGGAGTATTGG - Intergenic
1138212954 16:55178571-55178593 AGACTGCAGAATGGCAGAGCTGG - Intergenic
1139038012 16:62971166-62971188 ATACTTGAGTATGGGAGTGCTGG + Intergenic
1139535130 16:67567392-67567414 GGACTCCAGTATGGAAGTGTTGG + Intronic
1142041746 16:87898613-87898635 AGACTTGAGTGTGTGAGTGTTGG + Intronic
1142333062 16:89468089-89468111 AGACTGCAGTCTGGGCGTGGTGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1143306296 17:5949717-5949739 AGAATGAAGGATGGAAGTGTGGG - Intronic
1145915371 17:28571023-28571045 AGACTGCTGTGCGGGAGGGTCGG - Intronic
1146910378 17:36644781-36644803 AGACTGCAGGAAGGCAGTGGTGG + Intergenic
1148503169 17:48107381-48107403 AGTCTGCAGTGTGGGAGGTTCGG - Intronic
1150072823 17:62167122-62167144 GGACTGCAGTATGGGTGTGTGGG - Intergenic
1150875963 17:68970469-68970491 AGACTTGAGTTTGGGAGTTTAGG + Intergenic
1152825506 17:82462239-82462261 AGAATTCAGGGTGGGAGTGTAGG + Intronic
1157625455 18:49047221-49047243 GGACTGCAGTGTGGGGGTGCAGG - Intronic
1158646715 18:59254899-59254921 AGACTGCAGTTGGGGGGTGGGGG + Intergenic
1162558512 19:11402329-11402351 CCACTGTAGTAAGGGAGTGTGGG + Intronic
1164695613 19:30241410-30241432 ATACAGCAGAATGGGAGTGGGGG + Intronic
1165145577 19:33727950-33727972 AGCCTGCTCTTTGGGAGTGTGGG - Intronic
1165281692 19:34803392-34803414 ACACTGCAGTATAGGAGTTTCGG + Intergenic
1166193909 19:41193942-41193964 AGAATGCAGGATGGGAGGATGGG + Intronic
925360220 2:3274120-3274142 AGACTGCAGCGTGGGAATGTGGG + Intronic
930620260 2:53636052-53636074 AGGCTCCAGTAAGGGAGCGTGGG - Intronic
934925623 2:98380107-98380129 AGACTGGGGTTTGGGGGTGTGGG + Intronic
935987680 2:108690242-108690264 AGACTGCAGAATGGAGGGGTGGG + Intergenic
936126508 2:109792943-109792965 AGACTGCAGAATGGAGGGGTGGG + Intronic
936218185 2:110578525-110578547 AGACTGCAGAATGGAGGGGTGGG - Intergenic
936961072 2:118075256-118075278 AGACTGAGGTATTGGAGGGTTGG - Intergenic
938770651 2:134498301-134498323 AGACTGCAGCAGGACAGTGTGGG - Intronic
939759561 2:146157258-146157280 TAACTGCAGTAGGGGAGTGGGGG + Intergenic
943902163 2:193454590-193454612 ATATTGCAGCATGGGCGTGTAGG - Intergenic
945199216 2:207264619-207264641 AGGCTGCAGTCTGGGAGCCTGGG + Intergenic
945746390 2:213724056-213724078 AGACTGGAATAGGGAAGTGTAGG + Intronic
1171125512 20:22598721-22598743 AGAATGCAGTTTGGGAGTTCAGG - Intergenic
1171261755 20:23740200-23740222 AGATTGCAGCATGGGCATGTAGG - Intergenic
1171270898 20:23816092-23816114 AGATTGCAGCATGGGCATGTAGG - Intergenic
1172456934 20:35083922-35083944 AAACTGCAGTAGGGGAATGAAGG + Intronic
1175321305 20:58090299-58090321 GGAGTGCAGTCTGGGAGTTTGGG - Intergenic
1176696719 21:9986644-9986666 AGACTACAGTCTGGGAGTACGGG - Intergenic
1178563263 21:33659021-33659043 AAACTGCAGGATTGGAGGGTTGG + Intronic
1179090925 21:38264946-38264968 AGGGTTCAGCATGGGAGTGTGGG + Intronic
1180755935 22:18161218-18161240 AGAGTGCATTGTGTGAGTGTTGG - Intronic
1180869017 22:19135738-19135760 AGACTACAGGCTGGGAGTGGTGG + Intronic
1181020723 22:20100811-20100833 AGGCTGCAGTGTGGGAGGATCGG - Intronic
1181075833 22:20376185-20376207 AGAGTGCATTGTGTGAGTGTTGG + Intronic
1184078886 22:42203770-42203792 AGAATGGAGAAAGGGAGTGTGGG + Intronic
950407075 3:12811294-12811316 AGAATGGAGTCTAGGAGTGTTGG + Intronic
953709117 3:45255071-45255093 AGACTACACTGTGGGAGGGTCGG - Intergenic
960131895 3:114065676-114065698 ACATGGCAGTATGGGACTGTAGG - Intronic
961471769 3:127118553-127118575 AGCCTGCAGAAGGGGAGCGTGGG - Intergenic
962850323 3:139303590-139303612 AGACTTCAGTATAGGAATTTGGG + Intronic
963021518 3:140876646-140876668 ATACTGCAGCATGGGCATGTAGG - Intergenic
963932829 3:151022089-151022111 AGAGTACAGGATGGGAGTGCAGG - Intergenic
965530194 3:169764001-169764023 AGACTGCCGGCTGGGAGGGTTGG + Intergenic
965797519 3:172456815-172456837 AGATTGGAGTAGCGGAGTGTAGG - Intergenic
966923120 3:184627355-184627377 AGTCTGCAGTGTGGGGGTGGGGG + Intronic
967315802 3:188151309-188151331 AAACTGTTGTATGGGTGTGTTGG - Intergenic
967674920 3:192285954-192285976 AGACTGCAGTTTAGGAGAGATGG + Intronic
969195456 4:5559929-5559951 AGACTGCAGTGTGGAAATCTGGG + Intronic
970019678 4:11553928-11553950 GGACAGCAGGAAGGGAGTGTGGG - Intergenic
970322624 4:14889973-14889995 AGACTGCAGGAGGGGTGTGAGGG + Intergenic
971595422 4:28521772-28521794 AGACTGGAGTTTGGGACTGGGGG - Intergenic
972331385 4:38067498-38067520 ACAAGGCAGTATGGGAGGGTTGG + Intronic
973838887 4:54841047-54841069 AGACTGCACAATGGAAGTGAGGG - Intergenic
974838468 4:67277063-67277085 ATATTGCAGTATGGGCATGTAGG + Intergenic
977400144 4:96521510-96521532 AGTGTGCAGCATGGGACTGTCGG + Intergenic
980780198 4:137483374-137483396 AGACTGCCAGATGGGAGGGTAGG + Intergenic
981584343 4:146285069-146285091 AGACTGCAGTATGGGAGTGTAGG + Intronic
984510380 4:180671572-180671594 AGACTGCAGCCTGGGCGTGGTGG - Intergenic
986310548 5:6547695-6547717 AGACTGGAGTTTGGGAGCCTTGG - Intergenic
988358166 5:30202853-30202875 ATACTGCAGCATGGGCATGTAGG - Intergenic
988423653 5:31037416-31037438 AGAATCCAGAAGGGGAGTGTGGG + Intergenic
989445405 5:41522719-41522741 AAACTGAAGTATAGGAGTGTGGG - Intergenic
990492103 5:56312522-56312544 AGTCTGCAGTCTGGAAGTCTGGG + Intergenic
990804321 5:59641373-59641395 AGTCGGCAGTGTGGGAGTGATGG - Intronic
991141461 5:63248962-63248984 AGCCTGCAGGCTGGAAGTGTTGG + Intergenic
992629178 5:78664400-78664422 AGTCTGCATTCTGGTAGTGTAGG - Intronic
995859855 5:116629666-116629688 AAACTGCAGCATGGGAGTTGGGG + Intergenic
996690930 5:126339003-126339025 TGAGGACAGTATGGGAGTGTGGG - Intergenic
997101640 5:130975735-130975757 AGACTGGAGGTTGGGAGTGTGGG - Intergenic
998165290 5:139839187-139839209 AACCTGCAGCATGGGTGTGTTGG - Intronic
998621073 5:143794707-143794729 ACACTGGAGTATAGGAGAGTAGG + Intergenic
1002475394 5:179462193-179462215 AGCCTGCAGTGTGGGCGTGGTGG - Intergenic
1003557507 6:7153971-7153993 AGGCTGCAGTCTGGAAGTGATGG + Intronic
1005861678 6:29907288-29907310 AGACTGCAGGTTGGGGGTGAAGG + Intergenic
1005989039 6:30892000-30892022 AGACTGCAGTATGGGGGTCTGGG + Exonic
1006395157 6:33782430-33782452 AGAATGAAGTTTGGAAGTGTTGG - Intronic
1007880529 6:45160916-45160938 AATCTGCAGTGTTGGAGTGTGGG + Intronic
1008813720 6:55537662-55537684 TGCCTGCAGTATCAGAGTGTTGG - Intronic
1012338908 6:98093953-98093975 AGACTACACAATAGGAGTGTGGG + Intergenic
1016589267 6:145726470-145726492 AGACTACAGTATGGAAATATGGG + Intronic
1018074734 6:160201729-160201751 AGAGTGCAGCATGGGAGTAGAGG - Intronic
1021286467 7:18787132-18787154 AGACAGGACTCTGGGAGTGTGGG + Intronic
1021592984 7:22284760-22284782 AGAATGCAGAAATGGAGTGTAGG - Intronic
1021726066 7:23549269-23549291 AGACTGAAGAATGGAAGTGATGG + Intergenic
1021764364 7:23931962-23931984 CCACTGCAGTCTGGGAGTGCGGG - Intergenic
1021931085 7:25581996-25582018 TGACTGCAGGATGGGAGTAAAGG - Intergenic
1024273700 7:47660397-47660419 AGAGTGCAGGATGGGGGTGGGGG + Exonic
1024896326 7:54266013-54266035 AGACTGCTGTGTGGGGGTGGTGG - Intergenic
1025798339 7:64760557-64760579 ATATTGCAGTATGGGCTTGTAGG + Intergenic
1027423677 7:78041150-78041172 AGACTGCAGTATGCGATGGAAGG + Intronic
1028285704 7:88995686-88995708 AGAGTGCTGTATGGAAATGTGGG + Intronic
1029577194 7:101411414-101411436 AGACTGCAGGCTGGGAGGGCAGG + Intronic
1034968832 7:155407197-155407219 AGTGTGCGGTGTGGGAGTGTGGG + Intergenic
1035253483 7:157612173-157612195 AGCCTGCAGTTGTGGAGTGTGGG + Intronic
1036169425 8:6468369-6468391 AGCCTGCGGTCTGGGTGTGTGGG - Intronic
1036500205 8:9307340-9307362 GGACTGCAAGATGGGAGTCTTGG - Intergenic
1039134459 8:34304863-34304885 AGACTAAAGTAGGGCAGTGTGGG - Intergenic
1039954415 8:42196092-42196114 AGAGTGCAGTATGGACATGTTGG + Intronic
1042245242 8:66703547-66703569 AGGCTGCATTATAAGAGTGTCGG + Intronic
1042429059 8:68683147-68683169 AGCCTGCAGTACAGGAGTCTGGG - Intronic
1042562964 8:70087206-70087228 AGGCTGCATTATAGGTGTGTAGG + Intergenic
1042798066 8:72686240-72686262 AGTCTGCAGTATGAGCTTGTTGG + Intronic
1043677764 8:82980483-82980505 AGAATGGAGTATGGGAGGTTAGG + Intergenic
1045598637 8:103687661-103687683 AGACTGGGGTATGGGAGGTTAGG - Intronic
1045740512 8:105353228-105353250 ACAGTGCAGTATGAGAGTATGGG - Intronic
1046927166 8:119804325-119804347 AGTGTGCAGTGTGGGAGTTTTGG - Intronic
1049293922 8:141819644-141819666 AGACTGTGGAATGAGAGTGTGGG - Intergenic
1053633696 9:39972490-39972512 AGACTACAGTCTGGGAGTACGGG - Intergenic
1053772054 9:41491010-41491032 AGACTACAGTCTGGGAGTACGGG + Intergenic
1054210191 9:62278207-62278229 AGACTACAGTCTGGGAGTACGGG + Intergenic
1054314800 9:63570720-63570742 AGACTACAGTCTGGGAGTACGGG - Intergenic
1060072265 9:120560396-120560418 AGACAGCAGTATGGGTGGGTTGG - Intronic
1061919996 9:133777501-133777523 AGCCTGGCCTATGGGAGTGTGGG + Intronic
1190235721 X:48613914-48613936 AGACTGCAGTTTGGAAATGCTGG - Intergenic
1192482386 X:71496964-71496986 ATATTGCAGCATGGGAATGTAGG + Intronic
1195243491 X:102976212-102976234 GGACTGCAGTCTAGGAGTCTTGG - Intergenic
1199522390 X:148750555-148750577 AGACAGCAGTCTGGGAGAGATGG - Intronic