ID: 981584344

View in Genome Browser
Species Human (GRCh38)
Location 4:146285070-146285092
Sequence GACTGCAGTATGGGAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981584344 Original CRISPR GACTGCAGTATGGGAGTGTA GGG Intronic
904779761 1:32936923-32936945 GGCTGCAGTATGGGAGCGGGGGG + Exonic
904945218 1:34194071-34194093 GGCTGCAGTGTGGGAATGAATGG + Intronic
904978672 1:34478534-34478556 GACTCCAGTCTGGGATTGTCTGG + Intergenic
905891730 1:41522272-41522294 CTCTGCAGTATGGGGGTGAAGGG - Intronic
907046259 1:51302101-51302123 GACTGCAGCATTGCAGTGGAGGG - Intronic
915475827 1:156152333-156152355 GACATCAGGCTGGGAGTGTAGGG + Intronic
915718929 1:157969521-157969543 GAGTGCAGTAGGAGAGAGTAAGG + Intergenic
920388626 1:205585028-205585050 GACTGGAGTCTGGGGGTGAAGGG - Intronic
923096427 1:230778702-230778724 GGCTGAAGGATGGGAGCGTAGGG - Intronic
1065394190 10:25216678-25216700 CACTGCATTATGGGAGAATAAGG + Intronic
1067467293 10:46510661-46510683 CCCTGCAGTGTGGGAGTGCAGGG - Intergenic
1067619893 10:47873944-47873966 CCCTGCAGTGTGGGAGTGCAGGG + Intergenic
1067851453 10:49757390-49757412 CAGTGCCGTATGGGAGTGCACGG - Intronic
1070513329 10:77180638-77180660 CACTGCAGTATAGGAGGGTAGGG + Intronic
1075065706 10:119287702-119287724 GACAGCAGTGTGGGAGTGGGTGG - Intronic
1077580859 11:3416436-3416458 GACTGCAGAATGGGTGAGTCAGG + Intergenic
1082572377 11:54759399-54759421 GAGGGCAGTGTGGGAGTGGAAGG - Intergenic
1083150658 11:60789990-60790012 GACTGCAGTTTGGAAGAGTTGGG - Intronic
1085562375 11:77484079-77484101 CAATGTAGAATGGGAGTGTAGGG + Intergenic
1087194343 11:95290168-95290190 GAAGACAGTATGGGAGTGTCAGG + Intergenic
1087745030 11:101934153-101934175 GACTGCAGTAAGGAAAAGTAGGG - Intronic
1088544772 11:110948178-110948200 GGCCGCAGAATGGAAGTGTAGGG + Intergenic
1089196022 11:116694511-116694533 GATTGGGGTATGGGAGTGTGGGG - Intergenic
1090415843 11:126539937-126539959 TACTCCAGTCTGGGAGTGTTGGG + Intronic
1092273746 12:7043566-7043588 GACTGCAGTATGGAAGGGACAGG - Intronic
1092408459 12:8236863-8236885 GACTGCAGAATGGGTGAGTCAGG + Intergenic
1093637838 12:21492924-21492946 GTGTGAAGTATGGGAGGGTATGG - Intronic
1094613177 12:32013065-32013087 GACTTCAGAATGGGAGCATATGG - Intergenic
1096536512 12:52278556-52278578 GACTGCTGTCTGGGAGGGTCAGG + Intronic
1096711812 12:53463025-53463047 CACTGGAGTTTGGGAGTGAAGGG - Intronic
1096868775 12:54580338-54580360 GACTGCAGTTTGGGAATGCATGG - Exonic
1100684289 12:96969369-96969391 GACTGGAATATGAGAGTGCAGGG - Intergenic
1105983751 13:25545548-25545570 CACTGCACTATGGGAGTTAAAGG - Intronic
1108549964 13:51534176-51534198 GAATGAAGTATGGTAGTTTAGGG + Intergenic
1110300538 13:73921352-73921374 ATCTGGAGAATGGGAGTGTAAGG - Intronic
1116786426 14:49293763-49293785 GAATTCAGTATGAGAGTGAATGG - Intergenic
1118609677 14:67530401-67530423 GACAGCACTATGGGAGGGAAAGG - Intronic
1122020363 14:98833252-98833274 GGCTGGAGTGTGGGAGTGGAAGG - Intergenic
1128925050 15:71647817-71647839 GACTTCAATATGGGATTGCAAGG + Intronic
1129667361 15:77587079-77587101 GACTGCAGTTTGGGAATCTCTGG + Intergenic
1129978645 15:79846163-79846185 AACTGCAGTAAGGGTGTGTGGGG + Intronic
1130436536 15:83905239-83905261 GACTGCATGATGGTATTGTAAGG + Intronic
1136285518 16:29238302-29238324 GGCTTCAGTGAGGGAGTGTAAGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143131217 17:4678521-4678543 GACTGCAATAAAGCAGTGTACGG + Intronic
1143138947 17:4729663-4729685 CACTTGAGTATGGGAGTTTAAGG + Intergenic
1143820403 17:9556889-9556911 GCCTCTAGTATGGGAGTGTGAGG - Intronic
1149480500 17:56999577-56999599 GACTGCAGGTTGGGAGAGGAGGG - Intronic
1152703158 17:81829373-81829395 GACAGCAGTAAGGGAGGGTCAGG + Intronic
1152825507 17:82462240-82462262 GAATTCAGGGTGGGAGTGTAGGG + Intronic
1153097536 18:1424978-1425000 GACTGCATTGTGGCAGTATACGG + Intergenic
1157625454 18:49047220-49047242 GACTGCAGTGTGGGGGTGCAGGG - Intronic
1158677594 18:59535536-59535558 GTCTGAAGTATGGGAGGGGATGG + Intronic
1162558513 19:11402330-11402352 CACTGTAGTAAGGGAGTGTGGGG + Intronic
1163672107 19:18635716-18635738 GAATGGACTTTGGGAGTGTAAGG + Intergenic
926922181 2:17949916-17949938 GCCTGCAGTATGGGTGTGGGTGG + Intronic
927720545 2:25379209-25379231 GACTGCAGGAAGGGAGGGGAAGG + Intronic
931401770 2:61937948-61937970 GACTGTCGCATGAGAGTGTAAGG - Intronic
931820867 2:65951003-65951025 GAATGCAGTGTGTGAGTATAAGG + Intergenic
932539745 2:72639426-72639448 CAATGCAGTTTGGGGGTGTACGG - Intronic
934950308 2:98571333-98571355 GACTGCTGTAGGGGAGAGGATGG + Intronic
937656576 2:124383509-124383531 GACTGCAGTACCAGAGTGTATGG - Intronic
943753567 2:191535325-191535347 GGCTAAAGTATTGGAGTGTAAGG + Intergenic
946156899 2:217813021-217813043 GACTGCAGTTTGGCAGAGTTAGG + Intronic
946958090 2:224953882-224953904 GACTGCAGTTTGTGGGTGTGTGG + Intronic
948786768 2:240356779-240356801 GGCTCCAATATGGGAGTGGATGG + Intergenic
948898931 2:240946308-240946330 GTCTGCAGTGTGGCAGGGTATGG + Intronic
1170529110 20:17271858-17271880 GACTGCAAAATGGTAGTGCATGG - Intronic
1170888465 20:20359881-20359903 GCCTGGAGGATGGGAGGGTACGG + Intronic
1172456935 20:35083923-35083945 AACTGCAGTAGGGGAATGAAGGG + Intronic
1174587042 20:51617494-51617516 GACTGCGGCGTGGGAGTGGAAGG - Exonic
1176069303 20:63217728-63217750 GACTGCAGCAAGGGGGTGTCTGG + Intergenic
1179886771 21:44317535-44317557 GCCTGCAGGCTGGGAGTGCATGG - Intronic
1182486969 22:30645222-30645244 AACTGCAGTGTGGGAGTGATAGG + Intronic
1183489455 22:38108870-38108892 TACTGCATCATGGGAGTGTCTGG + Intronic
949847224 3:8384009-8384031 GACTACAGGATGGCAGTGTTTGG - Intergenic
951912125 3:27761766-27761788 GACTGGAAGGTGGGAGTGTAAGG - Intergenic
954576998 3:51681793-51681815 GGCTGCAGAAAGGGAGTGCAAGG + Intronic
955724235 3:61915419-61915441 GACTTCAATATGGCAGTGGAGGG + Intronic
961301116 3:125922651-125922673 GACTGCAGAATGGGTGAGTCAGG - Intergenic
961887409 3:130105422-130105444 GACTGCAGAATGGGTGAGTCAGG + Intronic
964085321 3:152810562-152810584 GACTGCATATTGGGAGTGAAAGG + Intergenic
964156462 3:153590668-153590690 TACTGCAGCATGGGGGAGTAGGG + Intergenic
967616380 3:191573133-191573155 TACTTCAGTATGGCAGTGTTAGG + Intergenic
968996533 4:3949344-3949366 GACTGCAGAATGGGTGAGTCAGG + Intergenic
969757467 4:9159342-9159364 GACTGCAGAATGGGTGAGTCAGG - Intergenic
969817427 4:9696878-9696900 GACTGCAGCATGGGTGAGTCAGG - Intergenic
972129362 4:35810685-35810707 GACTGCAGGATGGGAGAATTTGG + Intergenic
975958085 4:79866384-79866406 AACTTCTGGATGGGAGTGTAAGG - Intergenic
976828803 4:89289958-89289980 GGCTGTAGTATGGGAGGATATGG - Intronic
980324663 4:131325514-131325536 GAGTGCTGCATGGGAGTGTTTGG + Intergenic
981404701 4:144354613-144354635 GACTGGAGTATGGAAGTATCTGG + Intergenic
981584344 4:146285070-146285092 GACTGCAGTATGGGAGTGTAGGG + Intronic
987223907 5:15820234-15820256 GGCTGGAGTGTGGGAGTGTGTGG - Intronic
989088160 5:37698355-37698377 GGCAGCATTATGGGAGAGTATGG + Intronic
989445404 5:41522718-41522740 AACTGAAGTATAGGAGTGTGGGG - Intergenic
990799470 5:59584189-59584211 TACTGCAGTAAGAGATTGTAGGG - Intronic
991119406 5:62994070-62994092 GACTGCAGAAGGGAAATGTAGGG - Intergenic
991591051 5:68251796-68251818 GACTGCATTATGAGAGGGAAAGG + Intronic
993772973 5:91954181-91954203 GACTTCAGTATGTGAGAGTTTGG - Intergenic
995547520 5:113247832-113247854 GACGGCAGCAGGGGAGTGTATGG + Intronic
997101639 5:130975734-130975756 GACTGGAGGTTGGGAGTGTGGGG - Intergenic
997318868 5:132961671-132961693 ATCTACAGTTTGGGAGTGTAAGG - Intronic
997591078 5:135072709-135072731 GACAGCAGTCTGGGGGTGTGAGG + Intronic
998621074 5:143794708-143794730 CACTGGAGTATAGGAGAGTAGGG + Intergenic
999149108 5:149415013-149415035 GACAGCAGTGTGGGAGAGGATGG + Intergenic
1000462975 5:161545797-161545819 GACTGGGGGATGGGAGGGTAGGG - Intronic
1009694030 6:67073114-67073136 GACAGCAGAATGGCAGAGTAAGG - Intergenic
1014536066 6:122614422-122614444 GACTGCAGGAAGGGAGAGTCTGG - Intronic
1016704240 6:147088494-147088516 GACTGCAGTTTGGAAGTTAAAGG - Intergenic
1017640384 6:156487943-156487965 GGCTGCAGTATGGAAGTTGAAGG - Intergenic
1020320814 7:6937755-6937777 GACTGCAGAATGGGTGAGTCAGG + Intergenic
1021931084 7:25581995-25582017 GACTGCAGGATGGGAGTAAAGGG - Intergenic
1034330493 7:150278195-150278217 GAATGCAGCATGGGAGGGGAAGG - Intronic
1034667549 7:152831653-152831675 GAATGCAGCATGGGAGGGGAAGG + Intronic
1036380710 8:8234670-8234692 GACTGCAGAATGGGTGAGTCAGG - Intergenic
1036604653 8:10294635-10294657 GACTGCAATGTGGCAGTCTATGG + Intronic
1036848864 8:12187964-12187986 GACTGCAGAATGGGTGAGTCAGG + Intronic
1036870225 8:12430242-12430264 GACTGCAGAATGGGTGAGTCAGG + Intronic
1038483293 8:27916574-27916596 GACAGCAGTATGGGAATGCCTGG + Intronic
1042562965 8:70087207-70087229 GGCTGCATTATAGGTGTGTAGGG + Intergenic
1043677765 8:82980484-82980506 GAATGGAGTATGGGAGGTTAGGG + Intergenic
1045460820 8:102424307-102424329 GTCTGAAGTGTGGGAGTGCAAGG + Intergenic
1045598636 8:103687660-103687682 GACTGGGGTATGGGAGGTTAGGG - Intronic
1047706708 8:127506576-127506598 GAGTGCACTTTGGGAGTCTAAGG - Intergenic
1048141642 8:131800871-131800893 GACAGCAGTAAGTGGGTGTATGG + Intergenic
1050721839 9:8600058-8600080 GGCTGCAGCCTGGTAGTGTAAGG + Intronic
1051765047 9:20514148-20514170 CCTTGCAGTATGGAAGTGTAGGG + Intronic
1056725871 9:89116157-89116179 GACTGCAATATTGGAGTTGATGG - Intronic
1059777097 9:117487077-117487099 GAAAGCAGTATGGCAGTGTATGG - Intergenic
1194344889 X:92751218-92751240 GGCTGCAGTAGGGGAGGGAAAGG + Intergenic
1196332094 X:114484127-114484149 GAGTGCAGTATGGGACTTTCAGG - Intergenic
1200653230 Y:5867860-5867882 GGCTGCAGTAGGGGAGGGAAAGG + Intergenic