ID: 981585937

View in Genome Browser
Species Human (GRCh38)
Location 4:146302354-146302376
Sequence CTCTTTCAGCACATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981585934_981585937 21 Left 981585934 4:146302310-146302332 CCCTTACAGATCACAGAACTCTG 0: 1
1: 0
2: 0
3: 18
4: 239
Right 981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG No data
981585935_981585937 20 Left 981585935 4:146302311-146302333 CCTTACAGATCACAGAACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 158
Right 981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981585937 Original CRISPR CTCTTTCAGCACATATTTAT TGG Intronic
No off target data available for this crispr