ID: 981591299

View in Genome Browser
Species Human (GRCh38)
Location 4:146365812-146365834
Sequence CTTGGGGACCCCTGCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 3, 3: 76, 4: 364}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981591299_981591302 -10 Left 981591299 4:146365812-146365834 CCTCTTCAGCAGGGGTCCCCAAG 0: 1
1: 1
2: 3
3: 76
4: 364
Right 981591302 4:146365825-146365847 GGTCCCCAAGCCCTGGGCAGTGG 0: 1
1: 4
2: 70
3: 259
4: 923
981591299_981591310 15 Left 981591299 4:146365812-146365834 CCTCTTCAGCAGGGGTCCCCAAG 0: 1
1: 1
2: 3
3: 76
4: 364
Right 981591310 4:146365850-146365872 CAACCAGTCTGTGGCCTGTTAGG 0: 3
1: 10
2: 173
3: 409
4: 995
981591299_981591308 6 Left 981591299 4:146365812-146365834 CCTCTTCAGCAGGGGTCCCCAAG 0: 1
1: 1
2: 3
3: 76
4: 364
Right 981591308 4:146365841-146365863 GCAGTGGACCAACCAGTCTGTGG 0: 1
1: 0
2: 0
3: 39
4: 1100
981591299_981591312 22 Left 981591299 4:146365812-146365834 CCTCTTCAGCAGGGGTCCCCAAG 0: 1
1: 1
2: 3
3: 76
4: 364
Right 981591312 4:146365857-146365879 TCTGTGGCCTGTTAGGAACCCGG 0: 222
1: 654
2: 1039
3: 1150
4: 1145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981591299 Original CRISPR CTTGGGGACCCCTGCTGAAG AGG (reversed) Intronic
900099070 1:953324-953346 CTGGGGCATCCCTGCTGAGGAGG - Intronic
900614955 1:3561294-3561316 CCTGGGGACCCAAGCTGGAGAGG + Intronic
901467700 1:9433248-9433270 GTTTGGGACCCCTGCTGTAATGG + Intergenic
901581478 1:10247765-10247787 GTTGGGGACCACTGCTGTAGAGG - Intronic
901639688 1:10686961-10686983 CTTGGGTTCCCAGGCTGAAGGGG + Intronic
901852015 1:12021853-12021875 CTTGGGAACCCCAGAGGAAGGGG + Intronic
901937231 1:12635306-12635328 CTAGGGGAATCCTTCTGAAGCGG - Intergenic
902104242 1:14020307-14020329 TTTGGGGACCCCTGCTCTATAGG + Intergenic
903745564 1:25584492-25584514 CCTGGGGACCTCTGCTGGTGTGG - Intergenic
904256342 1:29257395-29257417 CCTGGGGAGCCCTCCTGGAGCGG + Intronic
904294691 1:29511713-29511735 GTTGGGGATCCCTGATCAAGAGG + Intergenic
904591584 1:31618144-31618166 CCTGGAGACCCCTGGGGAAGGGG - Intronic
905123483 1:35700864-35700886 GTTGGGGACCCCTGTTGTAAAGG - Intergenic
905784570 1:40743998-40744020 GTTGGGGACCCCTGCTCTAGTGG - Intronic
906410306 1:45573574-45573596 ATTAGGGTCCCCTGCAGAAGGGG + Intergenic
906727382 1:48054071-48054093 CATGAGGGCACCTGCTGAAGTGG + Intergenic
906806918 1:48787967-48787989 CTTTGGGACCCATTCTGGAGAGG + Intronic
907241667 1:53084416-53084438 TGTGGGGAGCCCTGCTGGAGGGG - Intronic
907350554 1:53826507-53826529 CTGAAGGACTCCTGCTGAAGAGG + Intronic
907489225 1:54798321-54798343 CCTGGGAACTCCTGCTGAAGGGG + Intronic
907828005 1:58037350-58037372 GTTGGGGACCCCTGCCGTAAGGG - Intronic
908328656 1:63048792-63048814 GTTGGGGACCCCTGCTCTATAGG + Intergenic
909020073 1:70420626-70420648 GTTGGGGACCCCTGCTTTAAAGG + Intronic
909330690 1:74406422-74406444 ATTGGGCACCCCTGCTCTAGAGG + Intronic
910322857 1:85968298-85968320 GTTGGGGACCCCTGCTATATTGG + Intronic
912063947 1:105712223-105712245 GTTGGGGACCCCTGGTTTAGAGG - Intergenic
913115516 1:115692730-115692752 CTGGCGGAGCCCTGCTGCAGGGG + Exonic
913450622 1:118990139-118990161 CTTGGGGAGCCCGGATGGAGAGG + Intergenic
914852778 1:151327273-151327295 CTGGGGGACCCCCGCGGAGGGGG + Exonic
914960719 1:152204106-152204128 GTTGGGGACCCCTGCTGTAAGGG + Intergenic
916406011 1:164498879-164498901 CTTGGGTGCCCCTGCTCTAGAGG + Intergenic
917137394 1:171800821-171800843 ATTGAGGACCCCTGGAGAAGAGG + Intronic
917348128 1:174049929-174049951 GTTGGGGACCCCTGGTCTAGTGG - Intergenic
921031885 1:211341225-211341247 TTTGGGGAACCCTGCAGGAGTGG + Intronic
921589865 1:216990915-216990937 GTTGGGGACCCCTGCTTTATAGG - Intronic
921830826 1:219725464-219725486 CTTGGGGATGCCTGCTCAGGGGG - Intronic
922085016 1:222338186-222338208 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
922333340 1:224597355-224597377 GTTTGGGACCCCTTCTGAAATGG - Intronic
922460010 1:225808730-225808752 ATTTGGGTCCCCTGGTGAAGTGG + Intergenic
922607899 1:226902365-226902387 GTTGGGGACCCCTGATTTAGAGG + Intronic
924741281 1:246795448-246795470 CCTGGGCACACCTGCTGGAGAGG - Intergenic
1064178459 10:13095691-13095713 TTTGGGGACCCCTGCTTTATTGG + Intronic
1064449913 10:15432371-15432393 GTTGGGGACCGCTGCTGCAGAGG + Intergenic
1065408830 10:25398884-25398906 GTTGGGGACCCCTGCTTTACTGG - Intronic
1066503575 10:36019136-36019158 GTTTGGGACCCCTGTTGTAGAGG - Intergenic
1067199626 10:44156037-44156059 CCTGGGGACCCCTGCTCTACTGG + Intergenic
1067792869 10:49301030-49301052 CCTGGAGACCCTTACTGAAGAGG + Intronic
1070842685 10:79498546-79498568 TGTGGGGACCCCTGCTGTAAAGG - Intergenic
1071439076 10:85674317-85674339 CTTGGGCACCCGTTCTGAGGGGG - Intronic
1071502434 10:86213324-86213346 CGTGGGGAGCCCTGCTGAGGTGG - Intronic
1073659926 10:105463641-105463663 GTTGGGGACCACTGGTGTAGAGG - Intergenic
1074220866 10:111436484-111436506 CTGGGGGACCCCTGATTTAGGGG + Intergenic
1074294316 10:112169676-112169698 GTTTGGGACCACTGCTGTAGAGG - Intronic
1075697824 10:124449070-124449092 CTGGCGGACACCTGATGAAGGGG - Intronic
1075792417 10:125094575-125094597 CTTGAGAGCCCCTGGTGAAGGGG - Intronic
1076057391 10:127386827-127386849 GTTGGGGACCGCTGCTGTAGTGG + Intronic
1076450428 10:130553547-130553569 GTTGGGGACCTCTGCTCTAGGGG - Intergenic
1077177297 11:1196674-1196696 CTTGGGCACTGGTGCTGAAGAGG - Intronic
1078396587 11:10987123-10987145 GTTGGGGACCCCTGCTCTACAGG - Intergenic
1078396640 11:10987457-10987479 GTTGGGGACTGCTGCTGTAGAGG + Intergenic
1078860095 11:15238959-15238981 GTCTGGGACTCCTGCTGAAGTGG + Exonic
1079227006 11:18615296-18615318 CTTTGGGACACTTGGTGAAGAGG + Exonic
1079569926 11:21930348-21930370 GTTGGGGGCCCCTGCTGTAGTGG - Intergenic
1080884495 11:36353862-36353884 GTTGGGGACCCCTGCTCCAGAGG + Intronic
1081816884 11:45950409-45950431 CTTGGACACCCCTGCTGTAGAGG - Intronic
1082767837 11:57182630-57182652 CCATGGAACCCCTGCTGAAGTGG + Exonic
1082841472 11:57693461-57693483 GTTGGGGACCCCTGCTTTAGTGG + Intronic
1083149685 11:60784023-60784045 GTTGGGGACCCCTGTTGTGGGGG - Intergenic
1083551888 11:63596345-63596367 GTTGGGGACCGCTGCTGTAGAGG - Intronic
1084438531 11:69157688-69157710 CTTGGGGGCGCCGGCTGCAGAGG + Intergenic
1084794586 11:71496596-71496618 GTTGGTGACCCCTGCTCTAGGGG + Intronic
1084956832 11:72696084-72696106 GTTGGGGACCACTGTTGTAGAGG - Intronic
1085654066 11:78296248-78296270 GCTGGGGACCCCTGCTCTAGGGG + Intronic
1085980512 11:81718512-81718534 CTTGGTTACCACTGCTGAAAAGG - Intergenic
1088335155 11:108695489-108695511 CTTGGGGCCACTTGCTGAAGTGG - Intronic
1088849840 11:113695624-113695646 CCTGGGGACCACTGATGAGGAGG - Intronic
1090974041 11:131666995-131667017 CTAGGGGACCCTAGCAGAAGGGG + Intronic
1091212244 11:133872012-133872034 GTTGGGGACCACTGCTGTAGAGG + Intergenic
1091288438 11:134422557-134422579 ACTGGGGACTCCTGCTGAATAGG + Intergenic
1091400084 12:176155-176177 CTTGGGCACCCCTGCTGGAAGGG - Exonic
1091405346 12:205298-205320 CTTAGTGACTCCTACTGAAGTGG - Intronic
1091574504 12:1720760-1720782 GTTGGGGACCCCTGCTGTATAGG + Intronic
1091648811 12:2294343-2294365 CTTGGGGAGCCCTGAAGAGGCGG + Intronic
1091782479 12:3222694-3222716 CTTGAGGACCACTGCAGAAAGGG - Intronic
1093168214 12:15829553-15829575 CTTGGGGACCCCTGATATAGGGG + Intronic
1093331152 12:17841769-17841791 GTTGGGGACCCCTGCTGTAAAGG + Intergenic
1094605842 12:31948404-31948426 CTTGGGGGCCAGTGCAGAAGTGG - Intergenic
1096431242 12:51545048-51545070 GCTGGGGACCCCTGCTGTAGAGG - Intergenic
1096651370 12:53063507-53063529 CCAGGGGACAGCTGCTGAAGGGG - Intronic
1097729035 12:63106769-63106791 GTTGGGGACCCCTGTTGTAAGGG + Intergenic
1099270079 12:80497534-80497556 ATTGGGGACCCCTGTTATAGAGG + Intronic
1100326802 12:93547843-93547865 CCTGGGGACTATTGCTGAAGAGG - Intergenic
1100416876 12:94387177-94387199 TTTGGGGACCCTTGCTTTAGAGG - Intronic
1100956815 12:99917804-99917826 ATTGGGGACCTCTGTTTAAGAGG - Intronic
1102329161 12:112014163-112014185 GTTGGGGACCCCTGCTTTACAGG - Intronic
1102827600 12:115962481-115962503 GTTGGGGACCCCTGCTCTAGGGG + Intronic
1103377721 12:120469657-120469679 CGGGGGGACCCGTGCTGAGGCGG - Exonic
1103434845 12:120916812-120916834 CTTGGGGGCCAGTGCAGAAGTGG - Intergenic
1105200685 13:18172264-18172286 GTTGGGGACCCCTGCTATAGAGG + Intergenic
1105500890 13:20970780-20970802 GTTGGGGACCCCTGCTTTAATGG + Intergenic
1106411039 13:29511650-29511672 CCTCAGGACCTCTGCTGAAGAGG - Exonic
1108174637 13:47779548-47779570 TTTGGGGACCACTGCTTTAGAGG - Intergenic
1108551346 13:51548665-51548687 CTTAAGGAGCTCTGCTGAAGTGG + Intergenic
1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG + Intergenic
1109654197 13:65368048-65368070 CTTGGGGACCTCTGCATTAGTGG + Intergenic
1111454618 13:88464927-88464949 GTTGGGGACCCCTGCTATAAAGG - Intergenic
1112902689 13:104378289-104378311 CTTGGGGACCCCTGGTTTAATGG - Intergenic
1113360069 13:109622632-109622654 GTTGGGGACCCCTGTTGTAAAGG - Intergenic
1113757447 13:112823003-112823025 CTCAGGGACCCCTGCTCTAGAGG + Intronic
1116125728 14:40782154-40782176 GTTGGGAACTCCTGGTGAAGAGG + Intergenic
1116400890 14:44505631-44505653 TATGGAGACCCCTGCAGAAGAGG - Exonic
1117107995 14:52418465-52418487 CTTGGGAACCCCTGGTTAAAGGG - Intergenic
1117404825 14:55391986-55392008 GTTGGGGACCACTGCTTTAGGGG - Intronic
1117559179 14:56918203-56918225 TTTGGGGACCCCTGATCTAGAGG + Intergenic
1118762398 14:68888582-68888604 GGTGGGGACCCCTGGTGTAGGGG - Intronic
1120017097 14:79486478-79486500 CTTGGAGACCACTGCTGTGGTGG + Intronic
1121442038 14:93955564-93955586 CAAAGGGACCCCAGCTGAAGTGG + Intronic
1122723087 14:103732873-103732895 CGTGGGCACCCCAGCTGAGGGGG - Intronic
1123208378 14:106735877-106735899 GTTGGGGACCACTGGTGTAGAGG - Intergenic
1123481681 15:20638336-20638358 GTTGGGGACCACTGGTGTAGAGG - Intergenic
1123636332 15:22362029-22362051 GTTGGGGACCACTGGTGTAGAGG + Intergenic
1123965543 15:25453363-25453385 GTTGGGGACCCCTGCTTTACAGG - Intergenic
1124386266 15:29210356-29210378 CTTGGGGACCCCTGATCTAGGGG - Intronic
1125756032 15:42065602-42065624 TTTGGTGACCTCTGCTGCAGAGG - Intergenic
1126344392 15:47677187-47677209 GTTGGGGACCCCTGTTGTAAAGG + Intronic
1126489922 15:49225610-49225632 GTTGGGGACTGCTGCTGTAGAGG + Intronic
1127254960 15:57281972-57281994 GTTGGGGACCACTGCTTTAGAGG + Intronic
1127334105 15:57966806-57966828 ACTAGGGATCCCTGCTGAAGGGG - Intronic
1128383305 15:67129109-67129131 GTTGGGGACGCCTGGTGTAGAGG - Intronic
1128618890 15:69132261-69132283 CCCGTGGACCCCTGCTGAGGGGG - Intergenic
1129007327 15:72384832-72384854 GCTGGGGACCCCTGATGTAGAGG - Intergenic
1129323280 15:74786604-74786626 CTGGGGAACACCTGCTGAGGAGG - Intronic
1129888582 15:79056055-79056077 CTGGGGGACCCCTGCCTCAGAGG - Intronic
1130914029 15:88290831-88290853 CTTGGGGCCCAGTGCTGGAGGGG - Intergenic
1132122198 15:99185757-99185779 CTTCCGGACCCCTGCGGCAGAGG + Intronic
1132532741 16:461347-461369 GTTGGGGACCCCTGCTGTAAAGG + Intronic
1132666493 16:1083425-1083447 CCAGGGCACCCCTGCTGATGGGG - Intergenic
1133120001 16:3600347-3600369 GTTGGGGACCCCTGCACTAGAGG + Intronic
1133376538 16:5291918-5291940 CTTGGGGTCCCTTTGTGAAGAGG + Intergenic
1133660294 16:7909899-7909921 GTTGGGGACTGCTGCTGTAGAGG - Intergenic
1133660350 16:7910377-7910399 CTTGGGGATCCCTGCTGTAAAGG + Intergenic
1134258219 16:12629384-12629406 CTTTGGGAGACCTGCTCAAGGGG + Intergenic
1134787252 16:16955853-16955875 GTTGGGGACCCCTGCTGTATCGG - Intergenic
1138109577 16:54312821-54312843 GTTGGGGACCCCTGCTGTATGGG + Intergenic
1141400315 16:83741775-83741797 GTTGGGGACCCCTGATGTAGGGG - Intronic
1142116851 16:88361338-88361360 GTTGGGGACCCCTGCCCTAGAGG + Intergenic
1143602000 17:7953149-7953171 GTTGGGGACCACTGCTCTAGGGG - Intergenic
1143908355 17:10227441-10227463 GTTGGGGACCCCTGCAGTAGAGG + Intergenic
1144940647 17:18937596-18937618 GTTGGGGACCCCTGATCCAGGGG + Intergenic
1145811457 17:27766687-27766709 CTTGGGGCATCCTGCTGAGGTGG + Intronic
1146458310 17:33024250-33024272 CTTGGAGACCTCTGCAAAAGTGG - Intronic
1147948899 17:44096099-44096121 CTTGGGGCTCCCTGCTGGTGTGG - Intronic
1148578305 17:48726563-48726585 CTTTGGGAACCCTGGTGGAGTGG + Exonic
1148622976 17:49048633-49048655 TTTGGGGACTCCTGTTGTAGAGG - Intronic
1148682531 17:49482932-49482954 CTTGGAGGCCCCTCCTGCAGCGG - Intergenic
1149420325 17:56504186-56504208 CTTGGGAAACACTGCTGTAGTGG - Intronic
1149774259 17:59344885-59344907 GTTGGGGACCACTGCTCTAGAGG - Intronic
1151263668 17:72937009-72937031 GTTGGGGACCCTTGCGGTAGAGG + Intronic
1151844204 17:76639989-76640011 GTTGGGGGCCCCTGCTGACTTGG + Intronic
1152155392 17:78629506-78629528 CTTGGGGAACCCAGCTGACCAGG - Intergenic
1152300956 17:79495239-79495261 CTTGGAGAAGCCTCCTGAAGGGG + Intronic
1152422315 17:80200558-80200580 GTTGGGGACTGCTGCTTAAGAGG - Intronic
1152945349 17:83194905-83194927 CCTGGGGACCCCTGCTCCAGAGG + Intergenic
1153021747 18:635475-635497 GTTGGGGACCCCTGCTATAAAGG + Intronic
1153767176 18:8385663-8385685 CTTGGGGGCCCCGGCTGGAAGGG + Intronic
1153836778 18:8970612-8970634 CTTGGGGACACCTGGCTAAGTGG - Intergenic
1155762576 18:29586344-29586366 GTTGGGGACCCCTGCACTAGAGG - Intergenic
1156432876 18:37094298-37094320 GTTGGGGACCCCTGCCTTAGAGG + Intronic
1157227872 18:45884169-45884191 CTTGGGGATCCCTGTTGTATAGG - Intronic
1157423139 18:47562788-47562810 GTTGGGGACCCCTGCTGTAAAGG - Intergenic
1157540146 18:48495853-48495875 GTTGGGGTCCCCTGCTCTAGGGG - Intergenic
1157587908 18:48817007-48817029 CCTGGGGACACCTGAAGAAGAGG + Intronic
1157795728 18:50573250-50573272 GTTGGGGACCCCTGGTCTAGAGG - Intronic
1158005830 18:52671090-52671112 CTTAGTGACCCCTGCTGGGGAGG + Intronic
1158227544 18:55216483-55216505 GGTGGGGACACCTGCTGAGGTGG - Intergenic
1158896812 18:61921952-61921974 GTTGGGGACCCCTGCTCTAGAGG - Intergenic
1159604963 18:70465811-70465833 CTTGGGGACCCCTGATATAGGGG - Intergenic
1160192511 18:76725752-76725774 GTTGGGGACCACTGCTTTAGAGG - Intergenic
1160271280 18:77386590-77386612 GTTGGGGACCCCTGCTTTAAAGG - Intergenic
1160579305 18:79874691-79874713 CTTGGAGACCCCAGTTGATGCGG - Intronic
1160767459 19:814782-814804 CCTGGGGACCCCAGCTCCAGTGG + Intronic
1160801884 19:974126-974148 CTTGGAGACCCCTGGGGAGGGGG + Exonic
1160974366 19:1785389-1785411 CCTGGGGACCCCTGCTTTGGGGG - Intronic
1160989907 19:1856253-1856275 CCTGGGGAGCCCAGCTGAGGAGG + Intronic
1161288576 19:3480768-3480790 CTTTGTGATCCCTGCTGCAGGGG + Intergenic
1162175354 19:8826167-8826189 GTTGGGGACCACTGCTCTAGAGG - Intronic
1162265185 19:9567454-9567476 GTTGGGGACCTCTGCTCTAGAGG - Intronic
1162790371 19:13059650-13059672 TTTGGGGAACCCTACTGGAGTGG + Intronic
1163124325 19:15236598-15236620 CTTGTGGACCCTGGCTGAGGTGG - Exonic
1163223480 19:15938263-15938285 GTTGGGGACCACTGCTGTAAAGG - Intergenic
1163384108 19:16988730-16988752 GTTGGGGACCCCTGCTCTAAGGG - Intronic
1164259309 19:23555386-23555408 GAAGGGAACCCCTGCTGAAGGGG - Intronic
1164671343 19:30073812-30073834 CTTGGCGCTCCCTGCTGGAGGGG + Intergenic
1165005337 19:32800984-32801006 CCTGGGGAACGCTGCTGCAGAGG - Intronic
1165821809 19:38681485-38681507 TTTGGGGACCCCAGGAGAAGTGG - Intronic
1166365033 19:42273955-42273977 CTTGGGGGCCCCTGGCGCAGGGG + Intronic
1166432483 19:42739344-42739366 CGTGCGGACCCCTGGGGAAGAGG - Intronic
1166435603 19:42764552-42764574 CATGCGGACCCCTGGGGAAGAGG - Intronic
1166445472 19:42854585-42854607 CATGCGGACCCCTGGGGAAGAGG - Intronic
1166448464 19:42878553-42878575 CATGCGGACCCCTGGGGAAGAGG - Intronic
1166452868 19:42916749-42916771 CGTGCGGACCCCTGGGGAAGAGG - Intronic
1166455360 19:42936046-42936068 CGTGCGGACCCCTGGGGAAGAGG - Intronic
1166465144 19:43025329-43025351 CATGCGGACCCCTGGGGAAGAGG - Intronic
1166471282 19:43081523-43081545 CATGCGGACCCCTGGGGAAGAGG - Intronic
1166482419 19:43185404-43185426 CGTGTGGACCCCTGGGGAAGAGG - Intronic
1166484900 19:43204496-43204518 CGTGCGGACCCCTGGGGAAGAGG - Intronic
1166492030 19:43268414-43268436 CGTGTGGACCCCTGGGGAAGAGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
924975228 2:167332-167354 TTTGGGGGCCCCTGCGGAACTGG - Intergenic
925462292 2:4074002-4074024 GTTGGGGACCCCTGCTGTAAAGG - Intergenic
925825261 2:7842014-7842036 CTTGGGGACCCCTGCCCTAATGG + Intergenic
927259502 2:21072747-21072769 CTTGGGGACCCCTGATCTATAGG + Intergenic
927348741 2:22080506-22080528 CTACTGGACCACTGCTGAAGAGG - Intergenic
927960467 2:27237930-27237952 CTTGTGGGCCCCTGCCTAAGTGG + Intronic
928040571 2:27872184-27872206 GTTGGGGACCCCTGCTCTACAGG + Intronic
929058174 2:37896860-37896882 GTTGGGGACTGCTGCTGTAGAGG - Intergenic
929070266 2:38021917-38021939 TTTAGGGACCCCTGCTATAGAGG + Intronic
929264101 2:39899370-39899392 ATTGGGGACCCCTGCTTTAAAGG - Intergenic
931377244 2:61718491-61718513 GTTGGGGATCCCTGCTACAGAGG - Intergenic
931509938 2:62980441-62980463 TTTGAGGACCCCTGCCTAAGAGG + Intronic
931550987 2:63446161-63446183 ATTGGGGACCCCTGGTTTAGAGG - Intronic
931665417 2:64606887-64606909 CTTGGACACTCCTGCTGAAGAGG + Intergenic
932599603 2:73114327-73114349 GTTGGGGACCCCTGCTATAGAGG - Intronic
933372189 2:81428625-81428647 CTTGGGGACCCCTGACACAGCGG + Intergenic
933941098 2:87245836-87245858 GTTGGTGACCCCAGCTGAGGAGG + Intergenic
934625815 2:95849955-95849977 GTTGGGGACCCCTGCTATAGAGG + Intronic
934807760 2:97251363-97251385 GTTGGGGACCCCTGCTATAGAGG - Intronic
934829750 2:97505824-97505846 GTTGGGGACCCCTGCTATAGAGG + Exonic
935108695 2:100072113-100072135 GTTGGGGACCCCTGATTTAGAGG - Intronic
936038644 2:109131309-109131331 CTTGGGGGGCACTGCTGAAGGGG + Intronic
936352043 2:111720176-111720198 GTTGGTGACCCCAGCTGAGGAGG - Intergenic
937910414 2:127073028-127073050 CATGGGGACCCCTGCTGTGGGGG - Intronic
937925266 2:127162927-127162949 CTTGTGGACCCCAGCTTCAGTGG - Intergenic
938924215 2:136024416-136024438 CTTGGGGACCCCAGCTGAGGAGG + Intergenic
939370386 2:141291962-141291984 GTTGGGGACCCCTGGTATAGGGG - Intronic
939966903 2:148619201-148619223 CTTGGGGAGCCTTGCTGAGGGGG - Intergenic
940853223 2:158707610-158707632 CTTGGGGACCCCTGATTTAGAGG + Intergenic
940918250 2:159281726-159281748 CTTTGGGAAGCCAGCTGAAGCGG + Intronic
941959370 2:171238719-171238741 GTTGGGGAACCCTGCTGTAAAGG - Intergenic
942420454 2:175801611-175801633 GTTGGGGACCCCTGCTTTAAAGG + Intergenic
942430567 2:175906872-175906894 GTTGGGGACCACTGATGTAGAGG - Intergenic
942674035 2:178407615-178407637 ATTGGACACCCCTGCTGTAGAGG + Intergenic
943905784 2:193499955-193499977 GTTGGGGACCCCTGGTCTAGAGG + Intergenic
946373132 2:219292699-219292721 ATTGGGGACCCCTGCTTTAGAGG - Intronic
947208233 2:227682166-227682188 TTTGGGGACCACTGCTCTAGAGG - Intergenic
947866665 2:233402561-233402583 CTTGGCAAGCCCCGCTGAAGAGG + Intronic
948846136 2:240683610-240683632 CTTGGGGGTCCCTGCTGAGGTGG - Intergenic
948847721 2:240691118-240691140 CTTGGGGGTCCCTGCTGAGGTGG + Intergenic
1169141634 20:3230154-3230176 CTGGGGGCCACCTGCTGAACAGG - Intronic
1169254648 20:4087532-4087554 GCTGGAGACCCCTGCTGCAGAGG + Intergenic
1170761036 20:19251826-19251848 CTTGGGGACCCCGGCTGCCCTGG - Intronic
1172034494 20:32001686-32001708 CTTGGGGGCCCCTGGTTAGGAGG + Exonic
1172149643 20:32780752-32780774 CTTGGAGAGCCCTTCTGCAGTGG + Intronic
1172382416 20:34506394-34506416 GTTGGGGACCCCTGCTTTAATGG - Intronic
1172626662 20:36351253-36351275 GTTGGGGACCCCTCTTGTAGGGG - Intronic
1174455870 20:50648442-50648464 GTTGGGGACCGCTGCTTTAGAGG - Intronic
1176913101 21:14591965-14591987 CTTGGCTTCCCCTGCAGAAGTGG - Exonic
1181988598 22:26819809-26819831 GTTGGGGACCCCTGGAGTAGAGG - Intergenic
1182745202 22:32600479-32600501 GTGGGGGACCCCTGCTCCAGAGG + Intronic
1183503773 22:38197058-38197080 TTTGGGGACCCCTGCTGTAGAGG + Intronic
1183564739 22:38605800-38605822 CTTGGGGACCACTGATCAAGAGG - Intronic
1183718759 22:39549982-39550004 CTTGGGGGTAGCTGCTGAAGAGG + Intergenic
1184591186 22:45484478-45484500 CTTGGGTACACCTTCTAAAGGGG - Intergenic
1184691883 22:46121114-46121136 CCTGGGGACCCAGGCTGAGGAGG + Intergenic
1185164968 22:49255802-49255824 CTCAGGGCCGCCTGCTGAAGAGG + Intergenic
949564249 3:5230372-5230394 GTTGGGGACCCCTGATCTAGTGG - Intergenic
950566504 3:13772633-13772655 CCTGGGTATCCCTGCTGCAGGGG + Intergenic
950624975 3:14238597-14238619 GTTGGGGACCCCTGGCAAAGAGG + Intergenic
951050627 3:18089376-18089398 GTTGGGGACCGCTGTTGTAGAGG - Intronic
952260475 3:31735189-31735211 CTTTGGGATCCCGGCTGAGGCGG + Intronic
954320847 3:49831126-49831148 CATGGGCACCCCTGTTGTAGAGG - Intronic
955479135 3:59371435-59371457 CTTTGGGCCTCCTGCTGAAATGG + Intergenic
956104360 3:65801799-65801821 TTTGGGGACCCCTGCTTTAGGGG - Intronic
956481882 3:69681310-69681332 CTGAGGGACCCCAGATGAAGGGG + Intergenic
957459077 3:80494243-80494265 GTTGGGGACCCCTGCTTTAGAGG - Intergenic
958163842 3:89853642-89853664 CTTGGGTGTCCCTGCTGATGAGG + Intergenic
958643477 3:96839144-96839166 GCTGGGGACCTCTGCTGTAGGGG - Intronic
959319652 3:104855389-104855411 CTTGTGGACTGCTGATGAAGAGG + Intergenic
960096215 3:113692187-113692209 CTTGGGGACCCCTGCCTTAGAGG + Intronic
961195041 3:124994340-124994362 GTTGGGGACCCCTGCCCCAGAGG + Intronic
961320506 3:126070208-126070230 GTTGGGGACCCCTGCTCTAAAGG - Intronic
961519533 3:127458892-127458914 CCTGGAGACCCCTGCTCTAGCGG - Intergenic
962285831 3:134084944-134084966 CTTAGGGAGCCCAGCTGAGGAGG - Intronic
965725319 3:171710038-171710060 GTTGGGGACCGCTGCTGTACGGG - Intronic
965725426 3:171710653-171710675 GTTGGCGACCCCTGCTCTAGAGG + Intronic
966163451 3:176991491-176991513 TTTGGGGACCCCTGCTCTAGAGG + Intergenic
967458799 3:189721544-189721566 CTTGGGTTGCTCTGCTGAAGTGG + Intronic
967721352 3:192819706-192819728 CTTGGGGACCACTCCAGCAGTGG - Intronic
968658510 4:1789168-1789190 CCTGGGTAGCCCTGCTGAACTGG - Intergenic
969264591 4:6056283-6056305 CTCTGGGACCCCTGCAGAAATGG - Intronic
969699168 4:8756917-8756939 GTTGGGGACCCCTGCTTCAGTGG - Intergenic
969778194 4:9375208-9375230 CTTGGTGTCCCATGCAGAAGGGG - Intergenic
971755258 4:30699385-30699407 GTTGGGGACCCCTGGTTTAGAGG + Intergenic
972014474 4:34226344-34226366 CTTGGTGACCTGTGTTGAAGTGG + Intergenic
972362548 4:38341238-38341260 GTTGGGGACCACTGCTCTAGAGG + Intergenic
972368669 4:38399950-38399972 GTTGGGGACCCCTGCTCTTGAGG + Intergenic
974652111 4:64767487-64767509 CTTTTGGACCCCAGCTGATGAGG + Intergenic
977173330 4:93789806-93789828 ATTGGGGACTCCTGCTCTAGAGG - Intergenic
978367941 4:108002154-108002176 GTTGGGGACCCCTGCTCTGGAGG - Intronic
978637309 4:110824666-110824688 GTTGGGGACCCCTGTTCTAGAGG + Intergenic
979566304 4:122157667-122157689 GTTGGGGACCCCTGATCTAGGGG + Intronic
979852535 4:125591598-125591620 TTTGGGGACTCCTGCTGTATAGG + Intergenic
979952139 4:126906592-126906614 GCTGGGGACCCCTGGTGTAGAGG - Intergenic
980974572 4:139598548-139598570 GTTGCAGACCCCTGCTGTAGAGG - Intronic
981591299 4:146365812-146365834 CTTGGGGACCCCTGCTGAAGAGG - Intronic
981609492 4:146578085-146578107 GTTGGGGGCCCCTGCTTTAGAGG + Intergenic
984311679 4:178068428-178068450 CTTGGGGACCCCTGTTCTAGGGG + Intergenic
986835017 5:11627622-11627644 GTTGGGGACCACTGCTGTAAGGG - Intronic
989552331 5:42750561-42750583 GTTGGGAACCCCTGCTCTAGAGG - Intergenic
990109160 5:52302624-52302646 CTTGAGGAGTGCTGCTGAAGAGG + Intergenic
990612172 5:57468579-57468601 TTTGGGGACCCCTGCCGTAAGGG + Intergenic
991036861 5:62135968-62135990 GTTGGGGACCCCTGTTTTAGAGG + Intergenic
991286486 5:64982780-64982802 GTTGGGGACCCCTGGTGTAAAGG - Intronic
991445687 5:66698032-66698054 CTTGGGAACCTCTGCTTCAGTGG + Intronic
992211406 5:74483546-74483568 GTTGGGGACCCCTGCTATATAGG - Intergenic
993110043 5:83645578-83645600 ATTGGATACCCCTGCTAAAGTGG + Intronic
994346682 5:98696148-98696170 CTTCTGAACCCTTGCTGAAGAGG + Intergenic
997416550 5:133732814-133732836 GTTGGCTACCCCTGATGAAGGGG + Intergenic
997689401 5:135815473-135815495 GTTGGGGACCCCTGCTATAAAGG + Intergenic
997693840 5:135845953-135845975 GTTGGGGACCCCTGGTCTAGAGG - Intronic
999687663 5:154117194-154117216 CCAGGGGACCCATGCTGAGGAGG + Intronic
1000224848 5:159250495-159250517 GTTGGGGACCCCTGCTTTAAAGG + Intergenic
1001349286 5:170941918-170941940 TTTGGGGACCCCTGTTCTAGAGG - Intronic
1003007234 6:2393145-2393167 GTTGGGGACCCCTGCATCAGGGG + Intergenic
1003231930 6:4262134-4262156 GTTGGGGACCCCTGGTTTAGAGG - Intergenic
1004311960 6:14553824-14553846 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
1004476604 6:15979260-15979282 CTTGGGGATCACTGCTCTAGAGG - Intergenic
1005901356 6:30219523-30219545 CTTAGGCACCCCTCCTGAAGGGG + Intergenic
1007118785 6:39363297-39363319 CTTGAGAACCACTGCTGCAGAGG - Intronic
1007712949 6:43836265-43836287 CCTGGTGACACCTACTGAAGGGG + Intergenic
1009439674 6:63662215-63662237 GTTGGGGGCCACTGCTGTAGAGG + Intronic
1009920916 6:70060368-70060390 GTTGGGGACCCCTGCTGTAGAGG - Intronic
1011013680 6:82730863-82730885 CTTGGAGGCCACTGCTGTAGAGG - Intergenic
1011035820 6:82973717-82973739 GTTGGGGACCTCTGCTGTACAGG - Intronic
1012753197 6:103189796-103189818 ATTGGGGACCCCTGATGTAAAGG - Intergenic
1013036264 6:106386875-106386897 ATTTGGGACCCCTGCTCTAGAGG + Intergenic
1013592627 6:111632134-111632156 CCTGGGGACCCCTGCTGCCCTGG - Intergenic
1013740713 6:113280588-113280610 GTTGGGGACCCCTGGTCTAGAGG + Intergenic
1014720515 6:124911950-124911972 GTTGGGGACCCCTGCTCTAGAGG + Intergenic
1016471964 6:144384190-144384212 CTTGGGGACCCCTGGTTTAATGG - Intronic
1017737128 6:157375536-157375558 TTTGGGGATCCCTGCTCTAGGGG - Intergenic
1018512490 6:164540460-164540482 GTTGGGGACCCCTGCTCTAGAGG - Intergenic
1018512558 6:164540975-164540997 TTTGGGGACCACTGCTCTAGAGG + Intergenic
1019466308 7:1191319-1191341 GTTGGGGACCCCTGGTCAACAGG - Intergenic
1019575941 7:1737685-1737707 CTTGAACACCCCTGCTGATGGGG + Intronic
1019867899 7:3730124-3730146 CTTAGGGACCATTGCTGATGAGG + Intronic
1020145027 7:5635574-5635596 CTTTGGGACCCTGGCTTAAGCGG - Intronic
1021498934 7:21307906-21307928 GTTGGGGACCTCTGCTGTAGGGG + Intergenic
1021877642 7:25063565-25063587 TTTGGGGACCGCTGCTTTAGAGG + Intergenic
1022708577 7:32830589-32830611 CTTGGAGACCCCTGCTCTAGAGG - Intergenic
1022914600 7:34934888-34934910 CTTGGAGACCCCTGCTCTAGAGG + Intronic
1023045779 7:36208960-36208982 CTTGGGAACCTCTCCTGGAGAGG + Intronic
1023742612 7:43294099-43294121 TTTGGGGACCGCTGCTGCAGGGG + Intronic
1023770790 7:43554811-43554833 TTCGGGGAAACCTGCTGAAGAGG + Intronic
1024626595 7:51213203-51213225 GTTGGGGACCGCTGCTGTAGAGG - Intronic
1024758718 7:52568236-52568258 TTTGGGGACCCCTGGTGTAGAGG + Intergenic
1025025837 7:55515389-55515411 CCTGGGGACCTCTGCTGCAGGGG - Intronic
1026310089 7:69175797-69175819 GTTGGGGACCCCTGCTCTAATGG - Intergenic
1026315136 7:69221288-69221310 GTTGGGGACCCCTGAGGAGGTGG + Intergenic
1026553751 7:71388883-71388905 GTTGGGGACCCCTGCTCTAGAGG - Intronic
1026624422 7:71979671-71979693 GTTGGGGACCCCTGCTCTATGGG + Intronic
1027137982 7:75638499-75638521 CTTGGGAACCCCAGCTTCAGTGG - Intronic
1028570260 7:92278952-92278974 GTTGGGGACCACTGCTCTAGGGG - Intronic
1029531039 7:101125555-101125577 GTTGGGTACCTCTGCTGTAGAGG - Intergenic
1030323231 7:108192091-108192113 TTTGGGGACCCGTGCTCTAGAGG - Intronic
1030323295 7:108192541-108192563 GTTGGGGACCACTGCTCTAGAGG + Intronic
1030626344 7:111849732-111849754 TCTGGGGACCCCTGCTCCAGTGG - Intronic
1030812461 7:113990341-113990363 CTTGGGTACCCAAGCTGATGTGG - Intronic
1031094626 7:117403740-117403762 GTTGGGGACCCCTGCTATAGTGG - Intronic
1031167304 7:118244543-118244565 TTAGGAGACTCCTGCTGAAGTGG + Intergenic
1032058620 7:128704835-128704857 GCTGGGGACCCCTGCTTTAGTGG + Intergenic
1032492148 7:132331706-132331728 CTTTGGGACCCCTGGAGAGGTGG - Intronic
1032587853 7:133164074-133164096 TTTGGGGACCCCTGTTTAATGGG + Intergenic
1032625191 7:133584292-133584314 CTTGGGGACCCCTGCAGGTGAGG + Intronic
1032792898 7:135255456-135255478 GTTGGGGACCCCTGCCCTAGAGG - Intronic
1034106958 7:148498397-148498419 ATTGGGAACCCCTGGTGTAGGGG - Intergenic
1034253708 7:149713503-149713525 GTTGGGGACCCCTGATTTAGGGG + Intergenic
1034521455 7:151623577-151623599 GTTGGGGACCCCTGCTCTAGTGG + Intronic
1034954674 7:155327106-155327128 CTTGGGGGCCCCTGCTGTCTTGG - Intergenic
1035227794 7:157443155-157443177 GTTGGGGACCCCTGCTGTTGGGG + Intergenic
1035720010 8:1784759-1784781 TATGGGGACACCTGCTGAGGGGG + Exonic
1036005445 8:4656861-4656883 GTTGGGGGCCCCTGCTGATTTGG - Intronic
1037241846 8:16786239-16786261 GCTGGGGACCCCTGCTTTAGGGG - Intergenic
1038432720 8:27512991-27513013 CTTGGGGACCCTTGCTGTCCTGG + Intronic
1038642113 8:29337152-29337174 CCTCGGGACCCCTGCGGGAGCGG - Exonic
1039597372 8:38802571-38802593 GTTGGGGACCACTGCTGTAAAGG + Intronic
1041867046 8:62585718-62585740 ATTGGGAACCCCTGCTTTAGGGG + Intronic
1043187777 8:77176682-77176704 CTTGGGATCTCCTCCTGAAGTGG - Intergenic
1043522776 8:81064132-81064154 GTTGGGGACCACTGCTTTAGAGG - Intronic
1043783139 8:84362408-84362430 GTTGAGGACCCCTGCTCTAGAGG - Intronic
1044067131 8:87712790-87712812 GTTGGGGACCCCTGATGTGGAGG - Intergenic
1044365135 8:91336250-91336272 ATTGAGGACCCCTGCTTCAGAGG - Intronic
1044995658 8:97835832-97835854 CTTGGGGACCCCTGATCTACAGG - Intronic
1045643855 8:104281297-104281319 GTTGGGGACCCCTGTTCTAGTGG + Intergenic
1045750290 8:105476195-105476217 GTTGGGGACCCCTGTTCCAGTGG - Intronic
1045750349 8:105476522-105476544 GTTGGGGACCCCTGCTCTAGAGG + Intronic
1045876951 8:106992735-106992757 GTTGGGGACCACTGCTTTAGAGG + Intergenic
1045932446 8:107642951-107642973 CCTGGGAACCCCTGCTATAGTGG + Intergenic
1047023915 8:120806992-120807014 CCAGGGGAGCACTGCTGAAGGGG + Intronic
1047055603 8:121161249-121161271 GTTGGGAAGCCCTGCTGCAGAGG - Intergenic
1048599069 8:135899745-135899767 GTTGGGGACCCCTTCTCTAGAGG - Intergenic
1050074189 9:1846800-1846822 GCTGGGGACCACTGCTGTAGAGG - Intergenic
1050074246 9:1847133-1847155 GTTGGGGACCCCAGCTCTAGAGG + Intergenic
1050431612 9:5568221-5568243 GTTGGGGACCCCTGCCTTAGAGG - Intronic
1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG + Intergenic
1052038033 9:23705554-23705576 GTTGGGGACCACTGCTCTAGGGG - Intronic
1052176639 9:25471419-25471441 GTTGTGGACCCTTGCTGGAGAGG + Intergenic
1053593304 9:39534309-39534331 CTTGGAGACCCCTGGGGGAGGGG - Intergenic
1053851037 9:42289017-42289039 CTTGGAGACCCCTGGGGGAGGGG - Intergenic
1054573002 9:66830968-66830990 CTTGGAGACCCCTGGGGGAGGGG + Intergenic
1054737579 9:68770813-68770835 GTTGGGGACCGCTGCTGTAGTGG + Intronic
1055433650 9:76270573-76270595 CCTGGGGACCCCTTCTGTGGGGG + Intronic
1055784290 9:79855713-79855735 GTTGGGGACCTCTGCTATAGAGG - Intergenic
1056275094 9:84986576-84986598 GTTGGGGATCCCTGCTCTAGAGG + Intronic
1057460189 9:95254069-95254091 CTTGGGGAACCCTGCTTTAGAGG + Intronic
1058906837 9:109488896-109488918 ATTGGGGACCCAGGCAGAAGAGG - Intronic
1059241296 9:112808199-112808221 TTTGAGGACCTCTGCAGAAGTGG - Intronic
1059347990 9:113645312-113645334 GTTAGGGACCCCTGCTATAGAGG - Intergenic
1060344716 9:122806092-122806114 GTTGGGGACCACTGCTATAGAGG + Intronic
1060839241 9:126781322-126781344 CTGAGGGACCCCTGCTAAGGGGG - Intergenic
1061232665 9:129323887-129323909 CTGGGGGACCCCTGGTTCAGAGG + Intergenic
1062005688 9:134237463-134237485 CCTGGGGTCCCCTGCTGCCGTGG + Intergenic
1062640353 9:137515473-137515495 CTGCTGGGCCCCTGCTGAAGAGG - Exonic
1203583668 Un_KI270746v1:41675-41697 GTTGGGGACCCCTGCTATAGAGG - Intergenic
1185479851 X:438143-438165 CGTGGGGGCCTCTGCCGAAGAGG + Intergenic
1185633137 X:1531395-1531417 CAGGGGGACCCCTGATGGAGAGG - Intronic
1186079863 X:5919465-5919487 CTTGGGGACCCCTGCTGTAGAGG - Intronic
1186996668 X:15131124-15131146 GTTGGGGACCCCTGGTCTAGAGG - Intergenic
1187460656 X:19484100-19484122 GTTGGGGACCCCTGCTCTAAAGG - Intronic
1187556611 X:20358036-20358058 GTTGAGGACCCCTGGTGCAGTGG + Intergenic
1187969547 X:24646173-24646195 CTTGAGGACACATGCTGAGGTGG + Intronic
1190261000 X:48796806-48796828 GTTGGGAACCCCTGCTGTAGAGG - Intergenic
1192265230 X:69533093-69533115 CTTGGCGACAACTGCTGGAGGGG + Intergenic
1193695674 X:84704847-84704869 CATGGGGACCCTGGCTAAAGAGG - Intergenic
1194678287 X:96819148-96819170 GTTGGGGACCCTTGTTGTAGAGG + Intronic
1195124258 X:101790015-101790037 GTTGGAGACCCCTGCTGTAGAGG - Intergenic
1195527043 X:105902912-105902934 TTTGGGGACCACTGTTGTAGTGG + Intronic
1195761234 X:108248697-108248719 GTTGGGAACCCCTGCTATAGAGG - Intronic
1197808797 X:130422886-130422908 GTTGGGGACCCCTGCTCTGGGGG - Intergenic
1198023998 X:132687237-132687259 CTTGGGGAACTCAGCAGAAGGGG + Intronic
1199981627 X:152923861-152923883 GTTGGGGACCCCTGATCTAGGGG + Intronic
1200062821 X:153491201-153491223 GTAGGGGACCCCTGCATAAGAGG + Intronic
1200175638 X:154114052-154114074 CGTGGGAACCACTGCTGGAGGGG - Intergenic
1201398626 Y:13577732-13577754 TTTGAGGACCCCTGCAGTAGTGG - Intergenic
1201514573 Y:14805161-14805183 ATTGGGGATCCCTGCTGTAGAGG + Intronic