ID: 981594020

View in Genome Browser
Species Human (GRCh38)
Location 4:146398905-146398927
Sequence CTGTGTAAGCAGCAGGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1032
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 964}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981594020 Original CRISPR CTGTGTAAGCAGCAGGAGAA CGG Intronic
900008533 1:83488-83510 GTTTGAAAGCAGCAAGAGAAAGG + Intergenic
900036764 1:417571-417593 GTTTGAAAGCAGCAAGAGAAAGG + Intergenic
900058393 1:653318-653340 GTTTGAAAGCAGCAAGAGAAAGG + Intergenic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900937869 1:5778282-5778304 CTGTATTAGAAGCATGAGAATGG + Intergenic
900951470 1:5860383-5860405 CTGCGGAAGCAGCAGGCTAACGG + Intergenic
901252607 1:7792089-7792111 CTTTATTAGCAGCATGAGAATGG - Intronic
901310749 1:8267722-8267744 CTCTATTAGCAGCATGAGAATGG - Intergenic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901750951 1:11408038-11408060 CTTTGTCAGCAGCATGAAAACGG + Intergenic
902065045 1:13678591-13678613 CTTTATTAGCAGCATGAGAACGG - Intergenic
902182959 1:14703594-14703616 CTTTATTAGCAGCATGAGAATGG + Intronic
902195931 1:14798127-14798149 CTGTGTAAGCGGCAGCAACAGGG - Intronic
902402194 1:16164272-16164294 GTGTGTGAGCTCCAGGAGAAGGG + Intergenic
903622174 1:24705704-24705726 ATGAGCAAGCAGCAGGAAAAAGG - Intergenic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
903796275 1:25931179-25931201 CTTTATAAGCAGCTTGAGAATGG + Intergenic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
904933213 1:34107056-34107078 CTGGATCAGCAGCAAGAGAAAGG + Intronic
905654743 1:39678828-39678850 CCTTCTAAGCAGCAGTAGAAAGG - Exonic
906369715 1:45242322-45242344 CTTTGTCAGCAGCATGAAAATGG - Intronic
906390117 1:45407812-45407834 CTTTATTAGCAGCATGAGAAAGG + Intronic
907174336 1:52504290-52504312 CTGTGAAAGAAGCCTGAGAAGGG - Intronic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
907625251 1:56023173-56023195 CTTTGTTAGCAGCATGAAAATGG - Intergenic
907713187 1:56903487-56903509 CTTTATTAGCAGCATGAGAATGG + Intronic
907840076 1:58148532-58148554 CTTTATTAGCAGCATGAGAATGG - Intronic
908075919 1:60517810-60517832 CTCAGCAAGCAGTAGGAGAAGGG - Intergenic
908112487 1:60910984-60911006 CTTTATTAGCAGCATGAGAACGG + Intronic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908541766 1:65129037-65129059 CTTTATTAGCAGCATGAGAACGG - Intergenic
908715956 1:67069160-67069182 CTTTATGAGCAGCATGAGAATGG + Intergenic
908800115 1:67871356-67871378 CTTTATTAGCAGCATGAGAATGG + Intergenic
909181574 1:72430179-72430201 CTTTATTAGCAGCATGAGAATGG + Intergenic
909189274 1:72531862-72531884 CTTTATTAGCAGCATGAGAATGG - Intergenic
909222091 1:72978344-72978366 CAGTGTAAGCAAGAGTAGAAGGG + Intergenic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
909371453 1:74887212-74887234 CTTTATTAGCAGCATGAGAAGGG + Intergenic
909457938 1:75870763-75870785 CTTTCTTAGCAGCATGAGAAAGG + Intronic
909510913 1:76451185-76451207 CTTTCTTAGCAGCATGAGAATGG - Intronic
909883060 1:80904707-80904729 CTTTATTAGCAGCATGAGAATGG - Intergenic
909984523 1:82144152-82144174 CTTTATAGGCAGCATGAGAATGG + Intergenic
910149062 1:84119450-84119472 CTTTGAAAGCATCAGTAGAAGGG - Intronic
910265222 1:85331218-85331240 ATGAGTAAGAAGCAAGAGAATGG - Intronic
910324102 1:85984594-85984616 CTATGTATGCACCAGGTGAAGGG + Intronic
910642820 1:89481789-89481811 CTTTATCAGCAGCAGGACAATGG - Intergenic
910707038 1:90140707-90140729 CTTTATTAGCAGCATGAGAATGG - Intergenic
911236470 1:95417752-95417774 CTTTATTAGCAGCATGAGAATGG - Intergenic
911387479 1:97194813-97194835 CTTTATTAGCAGCATGAGAATGG + Intronic
911650368 1:100381193-100381215 CTCTGGAAGCAAAAGGAGAAAGG - Intronic
911941510 1:104053253-104053275 CTTTATTAGCAGCATGAGAATGG - Intergenic
912013911 1:105007025-105007047 CTGTGTAAGAAGCATGAAAAAGG - Intergenic
912157918 1:106945274-106945296 CTTTATTAGCAGCATGAGAATGG - Intergenic
912712512 1:111960156-111960178 CTTTATTAGCAGCATGAGAACGG + Intronic
913208568 1:116564457-116564479 CTTTATTAGCAGCATGAGAATGG - Intronic
913286794 1:117233996-117234018 CTTTATTAGCAGCATGAGAACGG - Intergenic
913392307 1:118327864-118327886 CTTTATTAGCAGCATGAGAATGG + Intergenic
913481040 1:119289461-119289483 CTTTATTAGCAGCATGAGAATGG + Intergenic
915047356 1:153029548-153029570 CTTTGTCAGCAGCATGAAAATGG - Intergenic
915101740 1:153506024-153506046 CTTTGTCAGCAGCATGAAAACGG - Intergenic
915153952 1:153859022-153859044 CTGTGCAAGCAACAGTAAAAAGG + Intronic
915299083 1:154941822-154941844 CTGGGGAGGCAGCAGGAGACGGG + Intergenic
915900317 1:159842037-159842059 CTGTGTAAGCATCTGGGGGAAGG + Intronic
916828257 1:168464203-168464225 CTTTATTAGCAGCATGAGAACGG - Intergenic
916839713 1:168587099-168587121 CTTTATTAGCAGCATGAGAACGG - Intergenic
916845132 1:168642841-168642863 CTTTATAAGCAGCATGAAAATGG - Intergenic
916948668 1:169757465-169757487 CTTTATTAGCAGCATGAGAAAGG - Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917586329 1:176430807-176430829 CTTTATTAGCAGCATGAGAATGG - Intergenic
917606151 1:176631951-176631973 GAGTGTAAGCAAAAGGAGAAAGG + Intronic
917895164 1:179480180-179480202 CTTTATCAGCAGCATGAGAATGG - Intronic
918436256 1:184516466-184516488 CTTTGTCAGCAGCATGAAAATGG - Intronic
918614230 1:186525987-186526009 CTGTGGGAGGAGCAGGGGAAGGG - Intergenic
918717991 1:187817065-187817087 CTTTATTAGCAGCATGAGAATGG - Intergenic
919011848 1:191974868-191974890 CTTTATTAGCAGCACGAGAATGG - Intergenic
919135548 1:193503952-193503974 CTTTATAAGCAGCATGAAAATGG + Intergenic
919162224 1:193845189-193845211 CTTTATTAGCAGCATGAGAATGG + Intergenic
919166311 1:193898797-193898819 CTTTATAAGCAGCATGAAAATGG - Intergenic
919345877 1:196377647-196377669 CTTTGCAAGCAGAAAGAGAAGGG + Intronic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
921399374 1:214703664-214703686 CTTTATTAGCAGCATGAGAATGG + Intergenic
921540306 1:216406028-216406050 CTGTGGCAGCAGTAGGGGAAGGG + Intronic
921761888 1:218924286-218924308 CTTTATTAGCAGCATGAGAATGG + Intergenic
921970331 1:221141438-221141460 CTTTATTAGCAGCATGAGAATGG + Intergenic
922636569 1:227178803-227178825 CTTTGTTAGCAGCATGAAAATGG + Intronic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
923179278 1:231500254-231500276 CTTTATTAGCAGCATGAGAATGG - Intergenic
923295227 1:232588027-232588049 CTTTATCAGCAGCAGGAAAACGG + Intergenic
923340792 1:233005391-233005413 CTCACTCAGCAGCAGGAGAAAGG + Intronic
923490899 1:234483232-234483254 GGGTGTTAGCAGCAGGAGAAAGG - Intergenic
923762318 1:236858122-236858144 CTTTATCAGCAGCATGAGAATGG - Intronic
923808822 1:237289351-237289373 CTTTATTAGCAGCATGAGAAAGG - Intronic
923876691 1:238057696-238057718 CTTTATCAGCAGCATGAGAATGG - Intergenic
923911731 1:238454102-238454124 CTTTATTAGCAGCATGAGAATGG + Intergenic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
924020502 1:239776677-239776699 CTTTATTAGCAGCATGAGAATGG - Intronic
924055846 1:240123199-240123221 CTGTTCAGCCAGCAGGAGAACGG + Exonic
924075927 1:240336690-240336712 CTGTGTTAGTAACAGAAGAATGG + Intronic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063222152 10:3979202-3979224 CTTTATTAGCAGCATGAGAATGG + Intergenic
1063481350 10:6379448-6379470 CTTTATAAGCAGCATGAAAATGG - Intergenic
1063712253 10:8490945-8490967 CTTTATTAGCAGCATGAGAATGG + Intergenic
1063715449 10:8522251-8522273 CTTTATTAGCAGCATGAGAACGG - Intergenic
1063841526 10:10077065-10077087 CTTTATCAGCAGCATGAGAACGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1063885077 10:10569163-10569185 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1064129887 10:12700185-12700207 CTTTATTAGCAGCATGAGAATGG - Intronic
1064232891 10:13545018-13545040 CTTTATTAGCAGCATGAGAACGG + Intergenic
1064501353 10:15976926-15976948 CTTTATTAGCAGCATGAGAATGG + Intergenic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1065398402 10:25267171-25267193 CTTTATTAGCAGCATGAGAATGG - Intronic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1067900525 10:50236177-50236199 CTTTATTAGCAGCATGAGAATGG - Intronic
1068073841 10:52229471-52229493 CTGAGTAAGCCCCAGGAAAATGG + Intronic
1068747640 10:60553068-60553090 CTTTATCAGCAGCATGAGAATGG + Intronic
1068778380 10:60892130-60892152 CTTTATTAGCAGCATGAGAATGG + Intronic
1069078501 10:64063764-64063786 CTGTGTAATCAGCAAAAGCATGG - Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069828088 10:71266412-71266434 CTGAGTGAGCAGCAGAGGAAGGG - Intronic
1070005515 10:72420476-72420498 CTTTATTAGCAGCATGAGAATGG + Intronic
1070687495 10:78499842-78499864 CTTTGATAGCAGCATGAGAATGG - Intergenic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072250163 10:93575614-93575636 CTGTGTAAGCTGAAGGACACAGG - Intronic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1073669364 10:105570527-105570549 CTTTATTAGCAGCATGAGAATGG - Intergenic
1073811103 10:107152782-107152804 CTTTATTAGCAGCATGAGAATGG + Intronic
1073977869 10:109120538-109120560 CTTTATTAGCAGCATGAGAATGG + Intergenic
1074183383 10:111082037-111082059 CTGTGTATGCAGCAGTGGGAGGG + Intergenic
1074222831 10:111455131-111455153 CTTTATTAGCAGCATGAGAACGG + Intergenic
1074451607 10:113564003-113564025 CTTTATTAGCAGCATGAGAATGG - Intronic
1074491391 10:113942388-113942410 CTTTATTAGCAGCATGAGAACGG + Intergenic
1074500661 10:114020978-114021000 CTTTATCAGCAGCATGAGAACGG + Intergenic
1074784616 10:116827901-116827923 ATCTATATGCAGCAGGAGAAGGG - Intergenic
1074794425 10:116927327-116927349 CTTTATTAGCAGCATGAGAATGG - Intronic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075178840 10:120191514-120191536 CTTTATTAGCAGCATGAGAATGG - Intergenic
1075536758 10:123278027-123278049 CTTTATCAGCAGCATGAGAATGG - Intergenic
1075681270 10:124334546-124334568 CTTTATTAGCAGCATGAGAATGG - Intergenic
1075937698 10:126357517-126357539 CTTTATTAGCAGCATGAGAATGG - Intronic
1075985433 10:126780957-126780979 CTTTATTAGCAGCATGAGAATGG + Intergenic
1076160001 10:128236418-128236440 CTGTGCATGCAGCAGAGGAAGGG + Intergenic
1076716920 10:132370781-132370803 CTGTGTAGGCAGCAGAAAAAGGG - Intronic
1076841620 10:133048796-133048818 CTGGGAAAGCAGCTGGGGAAGGG - Intergenic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078104191 11:8348230-8348252 CTTTATTAGCAGCATGAGAATGG - Intergenic
1078517798 11:12039612-12039634 CTTTATCAGCAGCATGAGAATGG - Intergenic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079384284 11:19965156-19965178 CTGTGTCCTCAACAGGAGAATGG - Intronic
1079409598 11:20174901-20174923 CTTTATTAGCAGCATGAGAATGG + Intergenic
1079475625 11:20826187-20826209 CTTTATTAGCAGCATGAGAATGG + Intronic
1079568682 11:21915745-21915767 CTTTATTAGCAGCATGAGAATGG + Intergenic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1080194701 11:29595470-29595492 CTTTATTAGCAGCATGAGAATGG + Intergenic
1080447846 11:32353632-32353654 CTGTGTAGGAGGCTGGAGAATGG - Intergenic
1081238789 11:40678816-40678838 CTTTATTAGCAGCATGAGAACGG + Intronic
1081414170 11:42793389-42793411 CTTTATTAGCAGCATGAGAATGG + Intergenic
1081437397 11:43041849-43041871 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1083497680 11:63072569-63072591 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084298564 11:68229658-68229680 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1084367385 11:68711498-68711520 CTCTGTCAGCAGCAGGACTATGG - Intronic
1084738926 11:71125541-71125563 GTGAGGAAGCTGCAGGAGAAAGG + Intronic
1085866660 11:80302915-80302937 CTTTATCAGCAGCATGAGAATGG + Intergenic
1085873907 11:80383660-80383682 CTTTATTAGCAGCATGAGAATGG + Intergenic
1085979327 11:81704156-81704178 CTGTGTAACCAAGAAGAGAATGG - Intergenic
1086734218 11:90285663-90285685 GTGAGGAAGCTGCAGGAGAAAGG - Intergenic
1086772906 11:90791426-90791448 CTGCGTCAGCAGCATGAAAATGG + Intergenic
1086942519 11:92813175-92813197 CTTTATTAGCAGCATGAGAACGG + Intronic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1087321946 11:96673180-96673202 CAATCTAAGAAGCAGGAGAAGGG - Intergenic
1087472025 11:98587828-98587850 CTTTATTAGCAGCATGAGAATGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1087675496 11:101157259-101157281 CTTTATTAGCAGCATGAGAATGG + Intergenic
1087675777 11:101159307-101159329 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1087799284 11:102486705-102486727 CTAAGTAGGAAGCAGGAGAAAGG - Intronic
1088162958 11:106895704-106895726 CTTTCTTAGCAGCATGAGAATGG + Intronic
1088879568 11:113962926-113962948 CTGTGCAAGCAACAGAAGGAAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1090321401 11:125846834-125846856 CTTTATTAGCAGCACGAGAATGG - Intergenic
1090819306 11:130326669-130326691 CTGAGTAAGCGAGAGGAGAAGGG - Intergenic
1090914603 11:131152197-131152219 CTGAGTCCGCAGCAGGCGAAAGG + Intergenic
1091032609 11:132204564-132204586 CAATGTGAGTAGCAGGAGAAAGG + Intronic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1093013522 12:14132976-14132998 CTGGGTAGGTACCAGGAGAAGGG + Intergenic
1093973823 12:25399918-25399940 CTTTGTTAGCAGCATGAAAATGG + Intergenic
1094181665 12:27598165-27598187 CTTTATTAGCAGCATGAGAATGG - Intronic
1094299116 12:28940971-28940993 CTTTATTAGCAGCATGAGAATGG + Intergenic
1094434207 12:30403039-30403061 CTTTCTCAGCAGCATGAGAATGG + Intergenic
1094781467 12:33796436-33796458 CTTTATTAGCAGCAAGAGAATGG + Intergenic
1095147817 12:38751264-38751286 CTTTGTCAGCAGCATGAAAATGG + Intronic
1095262707 12:40115633-40115655 CAGTGGTAGCAGCAGCAGAAGGG + Intergenic
1095522490 12:43084406-43084428 CTTTATTAGCAGCATGAGAAAGG + Intergenic
1095640046 12:44477076-44477098 CTGTCTTATCAGCAGGAAAATGG + Intergenic
1095915149 12:47470708-47470730 CTTTATTAGCAGCATGAGAATGG + Intergenic
1096171394 12:49473907-49473929 CTTTATCAGCAGCAGGAAAACGG - Intronic
1097618225 12:61908530-61908552 CTTTATTAGCAGCATGAGAACGG + Intronic
1097638461 12:62150054-62150076 GTGTTTAAGCAGCAGGGGATGGG + Intronic
1098509288 12:71292658-71292680 CTTTGTTAGCAGCATAAGAATGG - Intronic
1098578257 12:72069527-72069549 CTTTATTAGCAGCATGAGAATGG - Intronic
1098578571 12:72071916-72071938 CTTTATTAGCAGCATGAGAATGG - Intronic
1098592421 12:72229151-72229173 CTTTTTTAGCAGCATGAGAATGG - Intronic
1099048327 12:77751686-77751708 CTTTATTAGCAGCATGAGAATGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099879198 12:88446289-88446311 CTTTATCAGCAGCAGGAAAAAGG - Intergenic
1099908467 12:88800411-88800433 CTTTATTAGCAGCATGAGAATGG - Intergenic
1100658087 12:96668318-96668340 CTTTATTAGCAGCATGAGAATGG - Intronic
1101127315 12:101650318-101650340 CTTTATTAGCAGCATGAGAACGG - Intronic
1101314786 12:103619131-103619153 CTTTATTAGCAGCATGAGAATGG + Intronic
1101449905 12:104766624-104766646 CTTTATTAGCAGCATGAGAATGG + Intergenic
1101576829 12:106005121-106005143 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1103264638 12:119618480-119618502 CTGTGAAAGCAGCTAGGGAAGGG + Intronic
1104010826 12:124928920-124928942 CTGTGGGGGCAGCAAGAGAAGGG + Intergenic
1104510820 12:129376203-129376225 CTTTATTAGCAGCATGAGAATGG - Intronic
1104528832 12:129549648-129549670 CTTTATCAGCAGCATGAGAATGG + Intronic
1104549518 12:129743578-129743600 CTTTATTAGCAGCATGAGAATGG + Intronic
1104598092 12:130133541-130133563 ATCTGTAAGCATGAGGAGAATGG - Intergenic
1104998814 12:132675461-132675483 CTGAGCATGCAGCAGGAGATAGG - Exonic
1106351983 13:28939775-28939797 CTTTGTTAGCAGCATGAAAACGG - Intronic
1107066591 13:36219998-36220020 CTTTATTAGCAGCATGAGAATGG + Intronic
1107312758 13:39097476-39097498 CTTTATTAGCAGCATGAGAATGG - Intergenic
1107342442 13:39422768-39422790 CTTTATTAGCAGCATGAGAATGG - Intronic
1107495302 13:40920461-40920483 CTGTGTATGGAGCAGCAAAAAGG - Intergenic
1107693815 13:42980339-42980361 CTTTATTAGCAGCATGAGAATGG - Intronic
1107733909 13:43375878-43375900 CTGTGTTAGGAAGAGGAGAAAGG - Intronic
1107766970 13:43745992-43746014 CTTTATTAGCAGCATGAGAATGG + Intronic
1108601717 13:52000632-52000654 CTGTGGGAGCAGCAGGGGAAGGG - Intronic
1108745514 13:53389417-53389439 CTTTATCAGCAGCATGAGAATGG - Intergenic
1108977389 13:56464410-56464432 TTGTGTATGCAGCAGGAGTGGGG - Intergenic
1109448131 13:62471953-62471975 CTTTATCAGCAGCATGAGAATGG - Intergenic
1109730101 13:66401525-66401547 CTTTATTAGCAGCATGAGAATGG + Intronic
1109740839 13:66552785-66552807 CTTTATTAGCAGCATGAGAATGG - Intronic
1110007905 13:70294914-70294936 CTTTATTAGCAGCATGAGAACGG + Intergenic
1110208815 13:72948628-72948650 CTTTATTAGCAGCATGAGAATGG - Intronic
1110466359 13:75806702-75806724 ATATGTAATCAGCAGGAAAAAGG - Intronic
1110559867 13:76899260-76899282 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1111046041 13:82814048-82814070 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1111074398 13:83214690-83214712 CTTTATCAGCAGCATGAGAATGG - Intergenic
1111254467 13:85647850-85647872 CTTTATTAGCAGCATGAGAAAGG + Intergenic
1111499877 13:89104580-89104602 CTTTATTAGCAGCATGAGAATGG + Intergenic
1111505572 13:89184588-89184610 CTCTATTAGCAGCATGAGAAAGG - Intergenic
1111539923 13:89656452-89656474 CTTTATTAGCAGCATGAGAAGGG + Intergenic
1111601736 13:90482719-90482741 CTTTATTAGCAGCATGAGAATGG - Intergenic
1111946244 13:94668715-94668737 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1112079161 13:95949130-95949152 CTTTATTAGCAGCATGAGAACGG + Intronic
1112159579 13:96853675-96853697 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1112218069 13:97456419-97456441 ATTTGTAATCAGCAGGAGATAGG + Intronic
1112359764 13:98706780-98706802 CTTTATCAGCAGCATGAGAATGG + Intronic
1112391921 13:98992776-98992798 CTTTATTAGCAGCATGAGAATGG + Intronic
1112610216 13:100948100-100948122 CTGTGGAAGCCCCAGGAGCAAGG - Intergenic
1112917320 13:104567405-104567427 ATGTGTACGAAGGAGGAGAAAGG + Intergenic
1113329679 13:109316258-109316280 CTTTATTAGCAGCATGAGAATGG - Intergenic
1113341885 13:109433624-109433646 CTTTATTAGCAGCATGAGAACGG - Intergenic
1113384502 13:109836151-109836173 CTCAGTAAGCGGCAGGTGAAGGG + Intergenic
1113386187 13:109850570-109850592 CTTTATTAGCAGCATGAGAACGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1114812692 14:25918404-25918426 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1114986625 14:28238078-28238100 CTTTTTAAGCAGCATGAGAATGG + Intergenic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115134608 14:30094078-30094100 CTTTATAAGCAGCATGAAAATGG - Intronic
1115430943 14:33317795-33317817 CTTTATTAGCAGCATGAGAATGG + Intronic
1115456287 14:33607711-33607733 CTTTATTAGCAGCATGAGAACGG - Intronic
1116286774 14:42984687-42984709 CTTTATTAGCAGCATGAGAATGG - Intergenic
1116542147 14:46112021-46112043 CTTTATTAGCAGCATGAGAATGG + Intergenic
1116608413 14:47033176-47033198 CTAATTAAGAAGCAGGAGAAAGG + Intronic
1116720977 14:48495183-48495205 CTTTATTAGCAGCATGAGAATGG + Intergenic
1116738052 14:48719589-48719611 CTTTATTAGCAGCATGAGAATGG - Intergenic
1116748638 14:48852985-48853007 CTTTATTAGCAGCATGAGAATGG - Intergenic
1117426570 14:55604656-55604678 CTGAGTAAACAGCAGTAAAAGGG - Intronic
1117639134 14:57778287-57778309 CTTTATCAGCAGCATGAGAATGG + Intronic
1117968984 14:61233869-61233891 CTTTTTTAGCAGCATGAGAATGG + Intronic
1118151319 14:63194070-63194092 CTTTATTAGCAGCATGAGAATGG + Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1118228743 14:63928008-63928030 CTTTATCAGCAGCATGAGAATGG + Intronic
1118302325 14:64626592-64626614 CTTTATTAGCAGCATGAGAATGG + Intergenic
1118481010 14:66165894-66165916 CTTTATTAGCAGCATGAGAACGG - Intergenic
1118809468 14:69262308-69262330 CTCTGGAAGGAGCAGGAGAGAGG - Intronic
1119132924 14:72191409-72191431 CTTTATTAGCAGCATGAGAAAGG - Intronic
1119142856 14:72283682-72283704 CTTTATCAGCAGCATGAGAATGG + Intronic
1119150689 14:72356900-72356922 CTTTATTAGCAGCATGAGAATGG + Intronic
1119465451 14:74854432-74854454 CTGAGTTAGCTGCAGGAGATGGG + Exonic
1120285336 14:82493369-82493391 CTTTATTAGCAGCATGAGAATGG + Intergenic
1120323095 14:82991002-82991024 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1120810213 14:88795246-88795268 CTTTATTAGCAGCATGAGAACGG - Intergenic
1120875264 14:89369504-89369526 CCTTGTCAGCAGCATGAGAATGG - Intronic
1120887825 14:89465531-89465553 CTTTATTAGCAGCATGAGAACGG + Intronic
1121300939 14:92870455-92870477 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301137 14:92872236-92872258 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301273 14:92873386-92873408 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121301407 14:92874539-92874561 CTTTATTAGCAGCATGAGAACGG - Intergenic
1121515580 14:94547808-94547830 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1122008032 14:98721937-98721959 CTTTATTAGCAGCATGAGAATGG + Intergenic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1124357445 15:29006488-29006510 CTGTATTAGCAGCATGAGAATGG - Intronic
1124511172 15:30327215-30327237 CTTTGTCAGCAGCATGAAAACGG + Intergenic
1124731742 15:32203550-32203572 CTTTGTCAGCAGCATGAAAACGG - Intergenic
1125100143 15:35902863-35902885 CTTTATTAGCAGCATGAGAATGG + Intergenic
1125230830 15:37453174-37453196 CTGTGGAAGCAGCCAGGGAAGGG + Intergenic
1126126595 15:45299542-45299564 CTTTATAAGCAGCATGAAAATGG + Intergenic
1126210576 15:46097060-46097082 CTGTGTATGCTGCAGTAGAAGGG - Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126909075 15:53399379-53399401 CTTTATTAGCAGCATGAGAATGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127006029 15:54571150-54571172 CTTTATTAGCAGCATGAGAATGG - Intronic
1127053133 15:55105694-55105716 CTTTATTAGCAGCATGAGAACGG - Intergenic
1127525654 15:59790238-59790260 CTTTATTAGCAGCATGAGAATGG + Intergenic
1127746919 15:61987289-61987311 CTTTATTAGCAGCATGAGAATGG - Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128535688 15:68488554-68488576 CTTTATCAGCAGCATGAGAACGG - Intergenic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1130036681 15:80367495-80367517 CTGTCTCATCAGCAGGAAAATGG + Intronic
1130320693 15:82838288-82838310 CTGTGCAATAAGCAAGAGAAAGG + Intronic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130573705 15:85071789-85071811 GTGTGTAAACAGGATGAGAAGGG + Intronic
1130711458 15:86285656-86285678 CTTTATTAGCAGCATGAGAATGG + Intronic
1131218675 15:90562343-90562365 CTGTTTAAGCATCAGTAAAATGG - Intronic
1131394652 15:92076896-92076918 CTTTATTAGCAGCATGAGAATGG - Intronic
1131562419 15:93456056-93456078 CTTTGTAACCAACAGGAGAAGGG - Intergenic
1131905030 15:97133756-97133778 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1132445021 15:101908633-101908655 GTTTGAAAGCAGCAAGAGAAAGG - Intergenic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133544848 16:6796014-6796036 CTTTGTCAGCAGCATGAAAATGG - Intronic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1134277911 16:12792901-12792923 CTTTATTAGCAGCATGAGAACGG + Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135037714 16:19091901-19091923 ATGTATTAGCAGCATGAGAACGG + Intergenic
1135609476 16:23853840-23853862 CTTTATTAGCAGCATGAGAATGG - Intronic
1135680153 16:24449637-24449659 CTTTATTAGCAGCATGAGAATGG - Intergenic
1135875084 16:26191258-26191280 CTTTATTAGCAGCATGAGAATGG + Intergenic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1137468568 16:48733681-48733703 CTGTGTATGCAACAGGTGAGGGG + Intergenic
1138220677 16:55247799-55247821 CTTTATCAGCAGCATGAGAATGG - Intergenic
1138861165 16:60759383-60759405 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1138899645 16:61253275-61253297 CTTTGTCAGCAGCATGAAAAAGG + Intergenic
1139061846 16:63262931-63262953 TTATGGAAGCAGCAGGGGAAGGG + Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1140552712 16:75884833-75884855 CTTTATTAGCAGCATGAGAATGG - Intergenic
1140649539 16:77071973-77071995 CTTTATTAGCAGCATGAGAATGG + Intergenic
1140654629 16:77126926-77126948 CTTTGTCAGCAGCATGAAAACGG - Intergenic
1141163987 16:81648037-81648059 CGGTGGAAGCAGCAGGGGGAGGG - Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141743592 16:85910941-85910963 CTGAGGAAGCGGCATGAGAAGGG + Intronic
1141902526 16:87001851-87001873 CTTTATTAGCAGCATGAGAATGG - Intergenic
1143739307 17:8941077-8941099 GTGTGTCAGCAGCAGGACAATGG + Intronic
1143760923 17:9103649-9103671 CTTTATTAGCAGCATGAGAATGG + Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146830866 17:36068463-36068485 CTGGGTAGGCAGCAGGCAAACGG - Intronic
1147185299 17:38710175-38710197 ATGGGTGAGCAGCGGGAGAATGG + Intronic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148224403 17:45888441-45888463 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149101128 17:52908424-52908446 CTTTATTAGCAGCATGAGAATGG + Intergenic
1149164023 17:53727917-53727939 CTTTATTAGCAGCATGAGAATGG - Intergenic
1149448389 17:56731462-56731484 CTTTATTAGCAGCATGAGAATGG + Intergenic
1149653292 17:58292491-58292513 TAGTGGCAGCAGCAGGAGAAGGG + Intergenic
1149671595 17:58417667-58417689 GTGTGTGAGCACCAGGAGGAGGG - Intergenic
1150168640 17:62967646-62967668 CTGTGTAAAAATCAGGAAAAGGG - Intergenic
1150506340 17:65702654-65702676 CTTTATTAGCAGCATGAGAATGG - Intronic
1150539609 17:66083403-66083425 CTTTATTAGCAGCATGAGAACGG + Intronic
1150579330 17:66457850-66457872 CTTTTTTAGCAGCATGAGAACGG + Intronic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151006939 17:70448818-70448840 ATGTGTCAGCAGCATGAAAATGG - Intergenic
1151075332 17:71265870-71265892 CTTTATTAGCAGCATGAGAATGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151997641 17:77620333-77620355 CTTTATCAGCAGCAGGAAAATGG - Intergenic
1152015121 17:77745521-77745543 CTTTATTAGCAGCATGAGAATGG - Intergenic
1152553042 17:81039328-81039350 CTGAGCAAGCACCAGCAGAAGGG - Intronic
1152993393 18:383749-383771 CTGTATTAGCAGCCTGAGAATGG - Intronic
1153161963 18:2216558-2216580 CTTTATTAGCAGCATGAGAATGG + Intergenic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1153925154 18:9828978-9829000 CTGTGACAGCAGCAGGTAAATGG - Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1155544879 18:26904572-26904594 CTTTGTTAGCAGCATGAAAATGG - Intergenic
1155689969 18:28607906-28607928 CTGTGCGAGCAGGAAGAGAAAGG + Intergenic
1156151441 18:34248866-34248888 CTTTATTAGCAGCATGAGAACGG - Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157619469 18:49007970-49007992 CTTTGGAGGCAGTAGGAGAATGG + Intergenic
1157661401 18:49448207-49448229 CTGTCTCATCAGCAGGAAAATGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158380386 18:56923539-56923561 CTGTGTTAGATGCAGAAGAAAGG + Intronic
1158743720 18:60173062-60173084 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159001935 18:62982081-62982103 CTGTGTCTGCTGCAGGAGAAAGG + Intergenic
1159136258 18:64340646-64340668 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159183823 18:64944781-64944803 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159183902 18:64945399-64945421 CTTTATTAGCAGCACGAGAAAGG - Intergenic
1159492853 18:69161279-69161301 CTTTATTAGCAGCATGAGAATGG - Intergenic
1159494922 18:69190184-69190206 CTTTATTAGCAGCATGAGAATGG + Intergenic
1159507006 18:69351671-69351693 CTTTATAAGCAGCATGAAAATGG - Intergenic
1160280330 18:77484346-77484368 TTCTGGTAGCAGCAGGAGAAAGG + Intergenic
1160294790 18:77628102-77628124 CTCTATTAGCAGCATGAGAATGG - Intergenic
1160517442 18:79486465-79486487 TGGTGTAGGCAGCGGGAGAAAGG - Exonic
1160640291 19:125081-125103 GTTTGAAAGCAGCAAGAGAAAGG + Intergenic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1161998211 19:7727560-7727582 CTTTATTAGCAGCATGAGAACGG + Intergenic
1163108502 19:15142034-15142056 CTTTACAAGCAGCAGGAAAATGG - Intergenic
1163152691 19:15424498-15424520 ATGGGTAAGCAACTGGAGAAAGG + Intronic
1163229992 19:15995016-15995038 CTTTATTAGCAGCATGAGAATGG + Intergenic
1163472003 19:17502891-17502913 CTTTATTAGCAGCATGAGAATGG - Intronic
1163939205 19:20477238-20477260 CTGGGTATGCACCAGGTGAAAGG + Intergenic
924976822 2:185021-185043 CTTTATTAGCAGCATGAGAATGG + Intergenic
925436544 2:3843106-3843128 CTGTGATAGCAGGGGGAGAAGGG + Intronic
925478858 2:4248083-4248105 CTTTATCAGCAGCAGGAAAATGG - Intergenic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926280410 2:11441615-11441637 CTTTATTAGCAGCATGAGAATGG - Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926946465 2:18192667-18192689 CTTTATTAGCAGCATGAGAATGG + Intronic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
928099432 2:28427317-28427339 CTGAGGAAGGAGGAGGAGAAGGG - Intergenic
928202112 2:29254245-29254267 CTTTATTAGCAGCATGAGAATGG + Intronic
928327547 2:30331842-30331864 CTTTATCAGCAGCATGAGAATGG + Intergenic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
928694366 2:33834027-33834049 CTTTATTAGCAGCATGAGAATGG + Intergenic
928749683 2:34457370-34457392 CTTTATTAGCAGCATGAGAATGG - Intergenic
928822224 2:35374993-35375015 CTGTGAAAGAAGCACCAGAAAGG + Intergenic
929043733 2:37771265-37771287 CTTTATTAGCAGCATGAGAAAGG + Intergenic
929211369 2:39360573-39360595 CTTTATTAGCAGCACGAGAATGG - Intronic
929215423 2:39406472-39406494 CTCTTTAAGCAGCAAGAGAAAGG + Intronic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929384155 2:41384414-41384436 CTGTGTAAGCACAGGAAGAAAGG - Intergenic
929448896 2:42023355-42023377 CTTTACAAGCAGCATGAGAATGG + Intergenic
929560317 2:42952483-42952505 CTTTATAAGCAGCATGAAAACGG + Intergenic
930457352 2:51622314-51622336 CTTTGTCAGCAGCACGAAAATGG - Intergenic
930514723 2:52392678-52392700 CTTTATTAGCAGCATGAGAATGG - Intergenic
930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG + Intergenic
930831378 2:55747258-55747280 GTGAGGAAGCTGCAGGAGAAAGG + Intergenic
931110992 2:59111366-59111388 CTTTGGAAGCAGCAAGAGAGAGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932440828 2:71733771-71733793 CTTTGTTAGCAGCATGAGAATGG - Intergenic
932742146 2:74299553-74299575 CTTTGTTAGCAGCGTGAGAATGG + Intronic
932987719 2:76747154-76747176 CTTTATTAGCAGCATGAGAATGG - Intergenic
933098926 2:78225872-78225894 CTTTATTAGCAGCATGAGAATGG - Intergenic
933303428 2:80568419-80568441 CTGTGCTAGAAGCAGGACAAGGG + Intronic
933361641 2:81293877-81293899 CTTTATTAGCAGCATGAGAAGGG + Intergenic
933381082 2:81546582-81546604 CTCTGGAAGCTGCTGGAGAAAGG + Intergenic
934019854 2:87936710-87936732 CTGAGAGAGAAGCAGGAGAATGG + Intergenic
935372697 2:102364682-102364704 CTTTATTAGCAGCATGAGAATGG - Intronic
935868671 2:107420775-107420797 CTTTATTAGCAGCATGAGAATGG - Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936595778 2:113846113-113846135 CTTTATCAGCAGCAGGAAAATGG + Intergenic
937607431 2:123818403-123818425 CTTTATTAGCAGCATGAGAATGG - Intergenic
938268148 2:129944263-129944285 GTGTGTGGGCGGCAGGAGAATGG + Intergenic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
938974417 2:136462070-136462092 CTTTATTAGCAGCATGAGAACGG - Intergenic
939094630 2:137820739-137820761 CTTTGTTAGCAGCATGAGCATGG - Intergenic
939314358 2:140528696-140528718 TTTTGTAAGCAGTAGGAGCAAGG + Intronic
939423268 2:142001203-142001225 CTTTATCAGCAGCATGAGAATGG + Intronic
939667267 2:144966614-144966636 CTTTGTTAGCAGCAAAAGAAAGG + Intergenic
939780914 2:146446479-146446501 CTTTATTAGCAGCATGAGAATGG - Intergenic
940189869 2:151029252-151029274 CTGTGTAAGCATCAACAGAAAGG - Intronic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940483985 2:154274718-154274740 CTTTATTAGCAGCATGAGAATGG + Intronic
940561769 2:155305786-155305808 CTGTATTAGCAGCATGAGAATGG + Intergenic
941067965 2:160924653-160924675 CTTTATTAGCAGCATGAGAATGG - Intergenic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941420997 2:165282558-165282580 TTGTTTAAGTAGCAGGAAAAAGG - Intronic
941607829 2:167621983-167622005 CTTTATTAGCAGCATGAGAATGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942424061 2:175840826-175840848 CTTTGTCAGCAGCATGAAAATGG - Intergenic
942733476 2:179083617-179083639 CTTTATTAGCAGCATGAGAAAGG - Intergenic
942846272 2:180429442-180429464 CTTTATTAGCAGCATGAGAATGG - Intergenic
943123992 2:183773335-183773357 CTTTATCAGCAGCATGAGAACGG + Intergenic
943238194 2:185348794-185348816 CTTTATTAGCAGCATGAGAATGG + Intergenic
943289464 2:186050328-186050350 CTTTATTAGCAGCATGAGAATGG - Intergenic
943502345 2:188707465-188707487 CTTTATTAGCAGCATGAGAACGG + Intergenic
943701790 2:190995302-190995324 CTTTATTAGCAGCATGAGAATGG - Intronic
943850607 2:192717482-192717504 CTTTATTAGCAGCATGAGAACGG - Intergenic
944251729 2:197585662-197585684 CTGTGTAAGCACAGGAAGAAAGG - Intronic
944458279 2:199917838-199917860 CTCTATTAGCAGCATGAGAATGG - Intronic
944937842 2:204588013-204588035 CTTTATTAGCAGCATGAGAATGG + Intronic
945123630 2:206485067-206485089 CTTTATGAGCAGCATGAGAATGG + Intronic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
945593779 2:211767481-211767503 CTTTATTAGCAGCATGAGAACGG - Intronic
946068406 2:217010060-217010082 CTATGAAAACAGCAGGAGATGGG + Intergenic
946477155 2:220018136-220018158 CTTTATTAGCAGCATGAGAACGG + Intergenic
946562338 2:220927249-220927271 CTTTATAAGCAGCATGAAAATGG - Intergenic
946677080 2:222171505-222171527 CTTTATTAGCAGCATGAGAATGG + Intergenic
946769781 2:223076981-223077003 CTTTATTAGCAGCATGAGAAAGG - Intronic
946974540 2:225133807-225133829 CTTTATCAGCAGCATGAGAATGG - Intergenic
947166316 2:227265772-227265794 CTTTATTAGCAGCATGAGAATGG - Intronic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947396865 2:229695234-229695256 CTTTATTAGCAGCATGAGAATGG + Intronic
947886360 2:233575344-233575366 CTTTATAAGCAGCATGAAAATGG - Intergenic
948007743 2:234624268-234624290 CTTTATTAGCAGCATGAGAATGG + Intergenic
948272276 2:236683756-236683778 CTGGGCAAGCATCAGGAGCAGGG - Intergenic
1168817926 20:753560-753582 CTATGAAAGAAACAGGAGAATGG + Intergenic
1168960018 20:1862542-1862564 TTGTGTGAGAAGCAGGAGCAAGG + Intergenic
1169836795 20:9889289-9889311 CTTTATTAGCAGCATGAGAACGG - Intergenic
1170286448 20:14715009-14715031 CTTTATTAGCAGCATGAGAATGG - Intronic
1170341022 20:15327361-15327383 CTTTATTAGCAGCATGAGAATGG - Intronic
1171055269 20:21900488-21900510 ATGTGTAAGCAGGAAGAGAGTGG + Intergenic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1171750011 20:29039572-29039594 CTTTATTAGCAGCATGAGAATGG - Intergenic
1172328639 20:34057976-34057998 GTGTCTCAGCTGCAGGAGAAAGG - Intronic
1173104480 20:40120296-40120318 CTGTGCATGCAGTAGTAGAAGGG - Intergenic
1173323246 20:42008984-42009006 CTTTATTAGCAGCATGAGAATGG - Intergenic
1174120433 20:48260771-48260793 GTGTGGAAGCATCAAGAGAATGG - Intergenic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174978312 20:55360972-55360994 CTGTGAAAACAACATGAGAAAGG + Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175230966 20:57472954-57472976 CTTTATTAGCAGCATGAGAATGG + Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1176315207 21:5236344-5236366 CTTTATTAGCAGCATGAGAATGG + Intergenic
1177344888 21:19855376-19855398 CTTTGTTAGCAGCATGAAAATGG - Intergenic
1177484304 21:21737178-21737200 CTTTATTAGCAGCATGAGAACGG - Intergenic
1177521933 21:22237969-22237991 CTTTATTAGCAGCATGAGAATGG + Intergenic
1177685795 21:24435565-24435587 CTGTATGAGCAGCATGAAAATGG + Intergenic
1177854363 21:26384599-26384621 CTTTATTAGCAGCATGAGAATGG + Intergenic
1178114542 21:29404175-29404197 CTTTATTAGCAGCATGAGAAGGG + Intronic
1178158855 21:29887776-29887798 CTATGTTCACAGCAGGAGAAGGG + Intronic
1178274942 21:31228731-31228753 CTTTGTTAGCAGCATGAGAATGG - Intronic
1178362465 21:31960506-31960528 CTTTATTAGCAGCATGAGAATGG - Intronic
1178745956 21:35250562-35250584 CTTTATCAGCAGCATGAGAATGG + Intronic
1179052841 21:37903462-37903484 CTTTGTTAGCAGCATGAGAATGG + Intronic
1179176765 21:39013574-39013596 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1179548909 21:42130912-42130934 CTGAGTAGGAAGCAGGAGAATGG - Intronic
1179793966 21:43771611-43771633 CTTTATTAGCAGCATGAGAATGG - Intergenic
1180218189 21:46339995-46340017 CTTTATTAGCAGCATGAGAATGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180392995 22:12302298-12302320 CTTTATTAGCAGCATGAGAATGG + Intergenic
1180406755 22:12562470-12562492 CTTTATTAGCAGCATGAGAATGG - Intergenic
1180723084 22:17923841-17923863 CTTTATTAGCAGCATGAGAATGG - Intronic
1182978260 22:34643681-34643703 CTAAGTGTGCAGCAGGAGAAGGG + Intergenic
1183801139 22:40165574-40165596 CTTTATTAGCAGCATGAGAATGG - Intronic
1184386263 22:44176737-44176759 CTCTTTTAGCAGCATGAGAATGG - Intronic
1184996510 22:48211028-48211050 CTGTGGGAGCAAGAGGAGAAGGG + Intergenic
1185396953 22:50597321-50597343 CGGTGTGAGGAGCAGGGGAAAGG + Intronic
1203295867 22_KI270736v1_random:42677-42699 CTTTATTAGCAGCATGAGAATGG + Intergenic
949280639 3:2342818-2342840 CTATTTTAGCAGCATGAGAATGG + Intronic
949474044 3:4425731-4425753 CTTTATTAGCAGCATGAGAATGG - Intronic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
949983957 3:9524015-9524037 CTGTGCAAGCAAGAAGAGAATGG - Intronic
950327117 3:12121226-12121248 ATGTGTAAGCAGAAAGAGACAGG - Intronic
950787564 3:15449201-15449223 CTTTGTCAGCAGCATGAAAATGG + Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
951291988 3:20882518-20882540 CTTTATTAGCAGCATGAGAATGG - Intergenic
951598414 3:24343296-24343318 CTGTTTAAGCACCAGAAGCAAGG + Intronic
951763638 3:26172425-26172447 CTGTATAAGCAGCATGAAAATGG + Intergenic
951947696 3:28159473-28159495 CTTTATTAGCAGCATGAGAATGG + Intergenic
952134998 3:30408563-30408585 CTTTATTAGCAGCATGAGAAAGG + Intergenic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
952741650 3:36739699-36739721 CTCTATAAGCAGCATGAAAAGGG + Intronic
953027283 3:39152567-39152589 CTGGGTGGGCAGCAGGAGACGGG + Intronic
953229731 3:41054153-41054175 CTTTATTAGCAGCATGAGAATGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954775837 3:53017703-53017725 AGGTATAAGCTGCAGGAGAAGGG - Intronic
955733770 3:62015303-62015325 CTGCTGAAACAGCAGGAGAAAGG + Intronic
956849118 3:73212192-73212214 CTTTATTAGCAGCATGAGAATGG - Intergenic
957061969 3:75489611-75489633 CTGTGTAAGCATCATAATAACGG - Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957267308 3:77983719-77983741 CTTTATTAGCAGCATGAGAATGG - Intergenic
957360589 3:79151239-79151261 CTTTATTAGCAGCATGAGAATGG + Intronic
957453323 3:80408506-80408528 CTGTGTAAGTGACAGGGGAAAGG - Intergenic
957527074 3:81391504-81391526 CTTTATCAGCAGCAGGAAAATGG - Intergenic
957987320 3:87589172-87589194 CTTTATAAGCAGCATGAAAAAGG - Intergenic
958076836 3:88691130-88691152 CTTTATCAGCAGCATGAGAACGG - Intergenic
958637368 3:96762650-96762672 CTTTATTAGCAGCATGAGAATGG + Intergenic
958831814 3:99099047-99099069 CTGTGAAAGCAGCCAGAAAAGGG + Intergenic
958886368 3:99732302-99732324 CTTTATTAGCAGCATGAGAAGGG - Intronic
959033224 3:101327570-101327592 CTTTATTAGCAGCATGAGAACGG + Intronic
959139878 3:102472870-102472892 CTTTATTAGCAGCATGAGAATGG - Intronic
959741960 3:109730868-109730890 CTTTATTAGCAGCATGAGAATGG - Intergenic
959915758 3:111815211-111815233 CTTTGTCAGCAGCATGAAAATGG + Intronic
960099481 3:113725015-113725037 CTTTATTAGCAGCATGAGAAAGG + Intronic
960217320 3:115057842-115057864 CTTTATTAGCAGCATGAGAACGG - Intronic
960430378 3:117561342-117561364 CTTTATTAGCAGCATGAGAATGG + Intergenic
960501900 3:118447994-118448016 CTTTATTAGCAGCATGAGAATGG - Intergenic
962067161 3:131993021-131993043 CTTTATTAGCAGCATGAGAATGG + Intronic
962646536 3:137445991-137446013 CTTTATTAGCAGCATGAGAATGG - Intergenic
962684909 3:137837992-137838014 CTTTATTAGCAGCATGAGAAGGG + Intergenic
962811636 3:138963370-138963392 CTGTGTAAACAGGAGGCGCATGG - Intergenic
962990303 3:140572001-140572023 CTGTGCCAGCAACAGGGGAAGGG + Exonic
963339608 3:144019104-144019126 CTTTATTAGCAGCATGAGAATGG - Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964525363 3:157611220-157611242 CTTTATTAGCAGCATGAGAACGG + Intronic
964954326 3:162334085-162334107 CTTTATTAGCAGCATGAGAATGG + Intergenic
966311187 3:178595774-178595796 CTTTATTAGCAGCATGAGAACGG + Intronic
966343337 3:178949939-178949961 CTTTATTAGCAGCATGAGAACGG + Intergenic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
967634860 3:191789868-191789890 CTTTATTAGCAGCACGAGAATGG - Intergenic
967640922 3:191862110-191862132 CTTTATTAGCAGCATGAGAATGG - Intergenic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969960385 4:10939345-10939367 CTTTATTAGCAGCATGAGAATGG + Intergenic
970076472 4:12227506-12227528 CCTTATTAGCAGCAGGAGAATGG - Intergenic
970422087 4:15914843-15914865 GTGGGCAAGCACCAGGAGAAGGG + Intergenic
970560708 4:17279571-17279593 CTTTATCAGCAGCATGAGAATGG - Intergenic
970635320 4:18004277-18004299 CTTTGTTAGCAGCATGAAAATGG - Intronic
970644014 4:18098654-18098676 CTTTATTAGCAGCATGAGAACGG - Intergenic
970985766 4:22155566-22155588 CTTTATTAGCAGCATGAGAATGG + Intergenic
971243586 4:24909958-24909980 CTTTATAAGCAGCATGAAAACGG + Intronic
971484690 4:27147293-27147315 CTTTATCAGCAGCATGAGAATGG - Intergenic
972017498 4:34264411-34264433 CTTTATTAGCAGCATGAGAATGG - Intergenic
972434189 4:39016001-39016023 CTTTGTCAGCAGCATGAAAATGG + Intronic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
972732734 4:41811280-41811302 CTTTGTCAGCAGCATGAAAATGG - Intergenic
972766217 4:42153731-42153753 CTGAGGAAGCTGCAGGAGAGAGG - Intergenic
972857228 4:43121361-43121383 CTTTGTCAGCAGCAAGAAAATGG - Intergenic
972900923 4:43682413-43682435 CTTTATTAGCAGCATGAGAATGG - Intergenic
973641851 4:52911005-52911027 CTTTATTAGCAGCATGAGAACGG + Intronic
973696332 4:53494382-53494404 CTTTATCAGCAGCAAGAGAATGG + Intronic
973909508 4:55565305-55565327 CTTTATTAGCAGCATGAGAACGG - Intronic
973969081 4:56192992-56193014 CTTTATTAGCAGCATGAGAATGG - Intronic
974255054 4:59441808-59441830 CTTTATTAGCAGCATGAGAATGG + Intergenic
974269463 4:59632389-59632411 CTTTGTCAGCAGCATGAAAATGG - Intergenic
974272219 4:59665089-59665111 CTGTGTTTGCTCCAGGAGAAAGG - Intergenic
974352786 4:60772182-60772204 CTTTGTCAGCAGCATGAAAATGG - Intergenic
974445593 4:61976838-61976860 CTTTATCAGCAGCATGAGAATGG + Intronic
974525260 4:63042933-63042955 CTGTGAAAGCAGCAGGTCAGGGG - Intergenic
974925403 4:68292082-68292104 CTGTGAAAGCAGCAGGGAAGGGG - Intergenic
974925425 4:68292183-68292205 CTTTATTAGCAGCATGAGAATGG - Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975453568 4:74560029-74560051 TTTTGAAAGCAGCAAGAGAAAGG + Intergenic
975495258 4:75029637-75029659 CTTTGTTAGCAGCATGAGAATGG + Intronic
976002887 4:80392720-80392742 CTTTATTAGCAGCATGAGAATGG + Intronic
976057255 4:81082502-81082524 CTTTGTCAGCAGCATGAAAAAGG + Intergenic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976366414 4:84237721-84237743 CTTTATTAGCAGCATGAGAACGG + Intergenic
976444965 4:85119107-85119129 CTTTATCAGCAGCAGGAAAATGG + Intergenic
976932763 4:90588925-90588947 CTTTATCAGCAGCATGAGAATGG + Intronic
976975057 4:91155448-91155470 CTTTATTAGCAGCATGAGAACGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977060995 4:92256669-92256691 AAGTGCAAGGAGCAGGAGAAGGG + Intergenic
977270473 4:94911919-94911941 CTTTATAAGCAGCATGAAAAAGG - Intronic
977356243 4:95951469-95951491 CTTTATTAGCAGCATGAGAATGG - Intergenic
978017308 4:103760724-103760746 CTTTGTTAGCAGCATTAGAATGG + Intergenic
978044827 4:104113590-104113612 CTTTATTAGCAGCATGAGAATGG - Intergenic
978106560 4:104909066-104909088 ATGTGTAAGCAGCAGGTAATAGG + Intergenic
979126110 4:116973800-116973822 CTTTATTAGCAGCATGAGAATGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979793382 4:124814577-124814599 CTTTATAAGCAGCATGAAAATGG - Intergenic
980161105 4:129164144-129164166 CTTTATTAGCAGCATGAGAATGG - Intergenic
980432040 4:132713897-132713919 CTTTATTAGCAGCATGAGAATGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982284334 4:153718922-153718944 CAGTGTAAGTAGCAAGAAAAGGG - Intronic
982919009 4:161250423-161250445 CTTTGAAAGCATCATGAGAAAGG + Intergenic
983124642 4:163935535-163935557 CTGAGGAAGCTGCAGAAGAAAGG - Intronic
983291249 4:165808804-165808826 CTTTGTCAGCAGCATGAAAACGG + Intergenic
983310716 4:166057556-166057578 CTGTATTAGCAGCGTGAGAATGG - Intronic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983889664 4:173017176-173017198 CTTTATTAGCAGCATGAGAATGG + Intronic
984043459 4:174767741-174767763 CTGTGCAAGCAGGAAGTGAAGGG - Intronic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
984286479 4:177735969-177735991 CTTTATTAGCAGCATGAGAATGG + Intronic
984326981 4:178267819-178267841 CTGTATTAGCAGCATGAAAATGG - Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984841409 4:184071358-184071380 CTTTATCAGCAGCATGAGAATGG - Intergenic
985110139 4:186539924-186539946 CTTTATCAGCAGCATGAGAATGG - Intronic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985431923 4:189889221-189889243 CTTTATTAGCAGCATGAGAATGG - Intergenic
985788502 5:1912481-1912503 CTTTATTAGCAGCATGAGAACGG + Intergenic
986077435 5:4352567-4352589 CTTTATTAGCAGCATGAGAATGG - Intergenic
986106735 5:4666995-4667017 CTTTATTAGCAGCATGAGAAGGG - Intergenic
986134246 5:4959402-4959424 CTGTGCAATAAGCAGGAGTAAGG - Intergenic
986640727 5:9869223-9869245 CTTTATTAGCAGCATGAGAATGG - Intergenic
986788147 5:11134124-11134146 CTGAGGAGGGAGCAGGAGAAAGG + Intronic
986844402 5:11735860-11735882 CTTTATTAGCAGCATGAGAATGG + Intronic
987087823 5:14486742-14486764 GTGTGCAAGAAGCAGGTGAAAGG - Intronic
987102086 5:14600374-14600396 CTTTATTAGCAGCATGAGAATGG + Intronic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
987153714 5:15066848-15066870 CTTTATTAGCAGCATGAGAATGG - Intergenic
987226471 5:15847151-15847173 CTGTATTAGTAGCATGAGAATGG - Intronic
987422595 5:17737918-17737940 CTTTATCAGCAGCACGAGAACGG + Intergenic
987457879 5:18169573-18169595 CTTTATTAGCAGCATGAGAATGG + Intergenic
987481154 5:18459485-18459507 CTTTATTAGCAGCATGAGAATGG + Intergenic
987585048 5:19843708-19843730 CTGTGAAAGCAGCCAGAGCAGGG + Intronic
987593433 5:19963728-19963750 CTTTATTAGCAGCATGAGAATGG + Intronic
987642222 5:20627844-20627866 CTTTATTAGCAGCATGAGAACGG - Intergenic
987680665 5:21132652-21132674 CTTTATCAGCAGCATGAGAATGG + Intergenic
987721460 5:21638708-21638730 CTTTATCAGCAGCAGGAAAATGG - Intergenic
987741798 5:21918411-21918433 CTTTATTAGCAGCATGAGAATGG - Intronic
987814373 5:22881638-22881660 CTTTATTAGCAGCATGAGAATGG - Intergenic
988042293 5:25905195-25905217 CTTTATTAGCAGCATGAGAATGG - Intergenic
988289418 5:29266663-29266685 CTTTATTAGCAGCATGAGAATGG - Intergenic
988356878 5:30187942-30187964 CTTTATTAGCAGCATGAGAATGG + Intergenic
988744523 5:34121314-34121336 CTTTATAAGCAGCATGAAAATGG - Intronic
988834975 5:35023242-35023264 CTTTATCAGCAGCATGAGAAAGG + Intronic
989479293 5:41910912-41910934 CTGTGTAAGCAGCTAAACAAAGG + Intronic
989523753 5:42429059-42429081 CTTTGTTAGCAGCATGAGAATGG - Intronic
989603220 5:43219347-43219369 CTTTATTAGCAGCATGAGAAAGG + Intronic
989637289 5:43549625-43549647 CTTTGTCAGCAGCATGAAAATGG + Intronic
989747860 5:44852824-44852846 CTTTATTAGCAGCATGAGAATGG - Intergenic
990077723 5:51872279-51872301 CTGTATTAGCAGCATGAAAATGG + Intergenic
990117384 5:52405141-52405163 CTTTATTAGCAGCATGAGAACGG + Intergenic
990174050 5:53087380-53087402 TTGTGTAAGCAGGAGGAGAAAGG - Intronic
990198276 5:53343077-53343099 CTTTATAAGCAGCATGAAAATGG + Intergenic
990279743 5:54237368-54237390 CTTTATTAGCAGCATGAGAATGG + Intronic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
990497603 5:56364134-56364156 CTTTATTAGCAGCATGAGAATGG + Intergenic
990861194 5:60329489-60329511 CTTTATTAGCAGCATGAGAATGG + Intronic
990903535 5:60779139-60779161 CAGTGAAAGCAGCAGGAAAGGGG - Intronic
991036405 5:62131946-62131968 GGGTGTAGGGAGCAGGAGAAGGG - Intergenic
991377981 5:65986202-65986224 CTGAGTAAGCAGCTGGATATAGG - Intronic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
993033588 5:82732483-82732505 CTTTGTCAGTAGCATGAGAATGG - Intergenic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
993761142 5:91799220-91799242 CTTTATTAGCAGCATGAGAATGG - Intergenic
994542434 5:101116888-101116910 CTTTGTTAGCAGCATGAGAATGG + Intergenic
994578474 5:101610555-101610577 CTTTATTAGCAGCATGAGAATGG - Intergenic
995050189 5:107694615-107694637 CTTTATTAGCAGCATGAGAACGG - Intergenic
995293891 5:110494994-110495016 CTATGAAAGCAGTAGGAGAATGG + Intronic
995380526 5:111527378-111527400 CTGTGGTAGCAGCAGATGAATGG - Intergenic
995429001 5:112053925-112053947 CTTTATTAGCAGCATGAGAATGG + Intergenic
996006703 5:118429731-118429753 CTTTATTAGCAGCATGAGAATGG - Intergenic
996042129 5:118827136-118827158 CTTTATTAGCAGCATGAGAATGG - Intergenic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
996460059 5:123731768-123731790 CTTTGTCAGCAGCATGAAAATGG + Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999517932 5:152319759-152319781 TTTTGTAAGCAGCAGGAAAGAGG + Intergenic
1000612335 5:163388015-163388037 CTTTATTAGCAGCATGAGAAGGG - Intergenic
1000624611 5:163525027-163525049 CTTTATTAGCAGCATGAGAATGG - Intergenic
1001054593 5:168438548-168438570 CTTTATTAGCAGCATGAGAACGG + Intronic
1001228336 5:169964417-169964439 ATGTTCAAGCAGCAGGAGAGAGG + Intronic
1001663908 5:173416700-173416722 CTTTGTTAGCAGCATGAGAATGG + Intergenic
1001694827 5:173662137-173662159 CTTTATCAGCAGCATGAGAATGG - Intergenic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002737057 5:181401291-181401313 GTTTGAAAGCAGCAAGAGAAAGG - Intergenic
1002747640 6:73488-73510 GTTTGAAAGCAGCAAGAGAAAGG + Intergenic
1002767979 6:259293-259315 CAGTGTCAGCAGCAGGGAAAGGG - Intergenic
1002961893 6:1923174-1923196 CTTTATCAGCAGCATGAGAACGG + Intronic
1003281584 6:4697265-4697287 CTTTGTTAGCAGCTTGAGAATGG - Intergenic
1003659479 6:8046341-8046363 CTTTATAAGCAGCATGAAAATGG + Intronic
1003791627 6:9552989-9553011 ATGTGTCGGCAGCATGAGAATGG - Intergenic
1004245799 6:13973761-13973783 CTTTATTAGCAGCATGAGAATGG + Intronic
1004489530 6:16100983-16101005 CTTTGTTAGCAGCGTGAGAATGG + Intergenic
1004700531 6:18075294-18075316 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1004813629 6:19288322-19288344 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1005350724 6:24932712-24932734 CTGTGTAACCTCTAGGAGAAAGG + Intronic
1005783558 6:29218704-29218726 CTTTATTAGCAGCATGAGAATGG + Intergenic
1006338471 6:33432972-33432994 ATCTGTGAGCAGCAGGAGAGGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007103785 6:39269321-39269343 CTGTGTAGGAAACAGGGGAAAGG + Intergenic
1008646470 6:53519474-53519496 CTGTGCTAGCAGGAGGAGATGGG - Intronic
1008658871 6:53644775-53644797 CTTTATTAGCAGCATGAGAATGG + Intergenic
1008966996 6:57322698-57322720 CTTTATTAGCAGCATGAGAATGG + Intronic
1009325829 6:62346542-62346564 GTGTGACAGCAGCAGAAGAAAGG - Intergenic
1009377661 6:62991759-62991781 CTTTATTAGCAGCATGAGAATGG - Intergenic
1009482977 6:64183283-64183305 CTTTATTAGCAGCATGAGAATGG + Intronic
1009501400 6:64419153-64419175 CTTTATTAGCAGCACGAGAATGG - Intronic
1009620187 6:66064858-66064880 CTTTATTAGCAGCATGAGAATGG + Intergenic
1009901123 6:69808721-69808743 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1010003688 6:70972904-70972926 CTTTATCAGCAGCATGAGAATGG + Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1011040973 6:83030563-83030585 CTTTATTAGCAGCATGAGAACGG + Intronic
1011125518 6:84003120-84003142 CTGGGTAAGCATCAGGTGATGGG + Intergenic
1011263891 6:85496249-85496271 CTTTATTAGCAGCATGAGAACGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012005908 6:93712633-93712655 CTTTATTAGCAGCATGAGAATGG + Intergenic
1012250994 6:96980821-96980843 CTTTATTAGCAGCATGAGAACGG - Intronic
1012390184 6:98729378-98729400 CTTTATTAGCAGCATGAGAAGGG + Intergenic
1012391135 6:98741319-98741341 CTTTATGAGCAGCATGAGAATGG + Intergenic
1013227255 6:108128974-108128996 CTTTATCAGCAGCAGGAAAATGG + Intronic
1013338560 6:109190828-109190850 CTTTATTAGCAGCACGAGAATGG + Intergenic
1013360489 6:109389758-109389780 CTTTGTCAGCAGCAATAGAAAGG - Intergenic
1013417159 6:109935353-109935375 CTTTATTAGCAGCATGAGAATGG - Intergenic
1013912054 6:115287688-115287710 CTGTGGTAGCAGTAGGAGAATGG - Intergenic
1013960451 6:115892832-115892854 CTGTGTAAGCCACAGCAGAGCGG + Intergenic
1014330826 6:120061412-120061434 CTGTATTAGCAGCATGAGAATGG - Intergenic
1014580976 6:123137017-123137039 CTTTATTAGCAGCATGAGAATGG + Intergenic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1014730796 6:125029925-125029947 CTTTGTCAGCAGCATGAAAACGG - Intronic
1015061853 6:128975865-128975887 CTTTATTAGCAGCATGAGAATGG + Intronic
1015199285 6:130561210-130561232 CTTTATTAGCAGCATGAGAATGG - Intergenic
1015216999 6:130761869-130761891 CTTTTTTAGCAGCATGAGAACGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015598259 6:134887259-134887281 CTTTATTAGCAGCATGAGAACGG - Intergenic
1015700732 6:136033499-136033521 CTGTGGGAGCAACAGCAGAAGGG - Intronic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015969557 6:138730556-138730578 CTGTGAAAGCAACTGGAGGAAGG - Intergenic
1015995651 6:138993290-138993312 CTTTATTAGCAGCATGAGAACGG + Intergenic
1015995930 6:138995242-138995264 CTTTATTAGCAGCATGAGAATGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016355150 6:143210307-143210329 CTTTATTAGCAGCATGAGAATGG + Intronic
1016524163 6:144981589-144981611 CTTTATTAGCAGCATGAGAATGG - Intergenic
1016682454 6:146846106-146846128 CTGTATTAGCAGCATGAGAATGG - Intergenic
1016815872 6:148302205-148302227 CTCGGGAGGCAGCAGGAGAATGG + Intronic
1016829204 6:148416941-148416963 CTGGGCAAGCAGCAGGTGATGGG + Intronic
1017531980 6:155302772-155302794 CTTTATTAGCAGCATGAGAACGG - Intronic
1017878747 6:158545096-158545118 CTGAGCAAGCCGCAGGGGAACGG - Intronic
1017991096 6:159490471-159490493 GTGTCTGAGCAGCAGGAGATGGG - Intergenic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1018585349 6:165350968-165350990 CTTTATTAGCAGCATGAGAACGG + Intronic
1019150704 6:170003754-170003776 CTTTATTAGCAGCATGAGAATGG - Intergenic
1019242153 6:170676861-170676883 GTTTGAAAGCAGCAAGAGAAAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019667115 7:2257489-2257511 CTGTGCGAGCGGCATGAGAAGGG - Exonic
1021138666 7:16996317-16996339 CTTTATTAGCAGCATGAGAATGG - Intergenic
1021228778 7:18060305-18060327 CTCTGTAGGCAGTGGGAGAATGG - Intergenic
1022038744 7:26559231-26559253 CTTTATTAGCAGCATGAGAATGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022863097 7:34388359-34388381 CTTTATTAGCAGCATGAGAATGG + Intergenic
1023162284 7:37309076-37309098 CTTTATTAGCAGCATGAGAACGG - Intronic
1023578723 7:41658274-41658296 CTGAGTAAGTACCAGGAGTAGGG - Intergenic
1023685595 7:42731540-42731562 CTTTATTAGCAGCATGAGAATGG + Intergenic
1024114631 7:46181058-46181080 CTTTATTAGCAGCATGAGAATGG - Intergenic
1024431805 7:49297310-49297332 CTTTTTCAGCAGCATGAGAATGG - Intergenic
1024625042 7:51200017-51200039 TTTTGAAAGCAGCAAGAGAAAGG + Intronic
1024771843 7:52732324-52732346 TTGTATTAGCAGCATGAGAATGG + Intergenic
1025708945 7:63890551-63890573 CTGTGGGAGCAGCAGGTGAGTGG + Intergenic
1026051467 7:66950576-66950598 CTTTATCAGCAGCATGAGAAAGG + Intronic
1026109433 7:67447110-67447132 CTTTATTAGCAGCATGAGAATGG + Intergenic
1026120250 7:67530399-67530421 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1026232558 7:68497930-68497952 CTTTATTAGCAGCATGAGAATGG + Intergenic
1027584646 7:80043698-80043720 CTTTCTCAGCAGCATGAGAACGG - Intergenic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028595035 7:92539146-92539168 CTCTGGAAGCAGCTGAAGAACGG + Intergenic
1028838430 7:95399884-95399906 CTATGTAAGCACCAAGTGAATGG + Intergenic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1029900217 7:104031102-104031124 CTTTCTTAGCAGCATGAGAATGG + Intergenic
1030527768 7:110674028-110674050 CTTTATTAGCAGCATGAGAATGG - Intronic
1030563399 7:111120212-111120234 CTCTATTAGCAGCATGAGAACGG - Intronic
1031174933 7:118338289-118338311 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1031413807 7:121472068-121472090 CTTTATTAGCAGCATGAGAACGG - Intergenic
1031521963 7:122777852-122777874 CTTTATTAGCAGCATGAGAATGG + Intronic
1031576096 7:123417564-123417586 CTGTGTAAGCAGCCAGAGTGGGG - Intergenic
1031778349 7:125930758-125930780 CTTTATCAGCAGCATGAGAAAGG - Intergenic
1032440495 7:131939131-131939153 CTTTATTAGCAGCATGAGAATGG + Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032703973 7:134406183-134406205 CTTTATCAGCAGCATGAGAATGG + Intergenic
1032865168 7:135917563-135917585 CTTTATTAGCAGCATGAGAACGG + Intergenic
1033048407 7:137982727-137982749 CTTTATCAGCAGCATGAGAACGG + Intronic
1033806138 7:144956068-144956090 CTTTGTTAGCAGCCTGAGAATGG + Intergenic
1034013011 7:147550545-147550567 CTTTATTAGCAGCATGAGAATGG + Intronic
1034029231 7:147741873-147741895 CTTTATCAGCAGCATGAGAATGG - Intronic
1034310342 7:150082317-150082339 TGGTGTAAAAAGCAGGAGAAAGG - Intergenic
1034358432 7:150472762-150472784 CTGAGTAGCCAGCAGGAGATAGG + Intronic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1034709570 7:153178970-153178992 CTTTTTGAGCAGCAGGAGAATGG - Intergenic
1034796503 7:154018336-154018358 TGGTGTAAAAAGCAGGAGAAAGG + Intronic
1035116533 7:156529289-156529311 CTTTATTAGCAGCATGAGAATGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035505965 8:131290-131312 GTTTGAAAGCAGCAAGAGAAAGG + Intergenic
1035796773 8:2364715-2364737 CTTTATTAGCAGCATGAGAATGG + Intergenic
1036123228 8:6040032-6040054 CTTTATTAGCAGCATGAGAATGG + Intergenic
1036495038 8:9262635-9262657 CTGAGGCAGGAGCAGGAGAATGG - Intergenic
1036593489 8:10191050-10191072 TAGTCTAAGCAGCAGAAGAATGG - Intronic
1036731657 8:11270848-11270870 CCGTGTCTGCAGCAGGAGACGGG - Intergenic
1036938925 8:13032483-13032505 CTATGTAACCAGCCTGAGAAAGG + Intergenic
1037151706 8:15643271-15643293 CTTTATTAGCAGCATGAGAATGG + Intronic
1037178527 8:15975059-15975081 CTTTATCAGCAGCATGAGAACGG + Intergenic
1037311249 8:17559225-17559247 CTTTATTAGCAGCACGAGAATGG - Intronic
1037452418 8:19029379-19029401 CTTTATTAGCAGCATGAGAATGG - Intronic
1037622122 8:20573544-20573566 CTGGGTAAGCTGCAGTAGAGAGG + Intergenic
1037626296 8:20610155-20610177 CTTTCTTAGCAGCATGAGAATGG - Intergenic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1037993613 8:23337939-23337961 CTTTATTAGCAGCATGAGAATGG - Intronic
1038150359 8:24937840-24937862 CTTTATTAGCAGCATGAGAATGG + Intergenic
1038194861 8:25358107-25358129 CTTTATTAGCAGCATGAGAACGG - Intronic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038393555 8:27229279-27229301 CTTTATTAGCAGCATGAGAATGG + Intergenic
1038913490 8:31993693-31993715 CTTTATCAGCAGCATGAGAATGG + Intronic
1039029412 8:33293506-33293528 CTTTATCAGCAGCATGAGAATGG - Intergenic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1040583564 8:48717269-48717291 TTTTGAAAGCAGCAAGAGAAAGG + Intronic
1040797633 8:51303361-51303383 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1041128595 8:54671239-54671261 TCGTGGAAGCAGCAAGAGAAAGG - Intergenic
1041333846 8:56757871-56757893 CTTTATTAGCAGCATGAGAATGG - Intergenic
1041869574 8:62617606-62617628 CTTTCTATGCAACAGGAGAAAGG - Intronic
1042052890 8:64731131-64731153 CTTTATTAGCAGCGGGAGAATGG + Intronic
1042509318 8:69594559-69594581 CTGTGTAAGCCACAGGACAAAGG + Intronic
1042684447 8:71422557-71422579 CTTTATTAGCAGCATGAGAATGG - Intronic
1042776031 8:72432408-72432430 CTCTATTAGCAGCATGAGAATGG - Intergenic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1042974011 8:74444255-74444277 ATGTGTCAGCAGCAGGGAAAAGG - Intronic
1043794786 8:84522870-84522892 CTTTATTAGCAGCATGAGAATGG - Intronic
1043794814 8:84523102-84523124 CTTTATTAGCAGCACGAGAATGG - Intronic
1044234119 8:89810162-89810184 CTTTATTAGCAGCATGAGAATGG + Intergenic
1044324665 8:90846599-90846621 CTTTATTAGCAGCATGAGAATGG - Intronic
1044628584 8:94257955-94257977 CTGTGTAAGAAGCTAGGGAAAGG + Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045785435 8:105915839-105915861 CTGTGTAAGGAGGGTGAGAAGGG - Intergenic
1046244382 8:111539402-111539424 CTTTGTTAGCAACATGAGAAGGG - Intergenic
1046252283 8:111647973-111647995 CTAGGTAAGCAGCAGGGTAAAGG + Intergenic
1046452105 8:114406591-114406613 CTTTATTAGCAGCATGAGAATGG - Intergenic
1046506860 8:115147588-115147610 CTTTATTAGCAGCATGAGAATGG - Intergenic
1046519804 8:115309568-115309590 CTTTATAAGCAGCATGAAAACGG - Intergenic
1046600687 8:116314242-116314264 CTTTATCAGCAGCATGAGAATGG - Intergenic
1046613565 8:116451571-116451593 CTTTATTAGCAGCATGAGAAAGG - Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1046940337 8:119924924-119924946 CTTTATTAGCAGCATGAGAATGG - Intronic
1047206712 8:122808259-122808281 CTTTATTAGCAGCATGAGAATGG - Intronic
1047487858 8:125348830-125348852 CTTTATTAGCAGCACGAGAACGG + Intronic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1048260847 8:132943873-132943895 CAGTTTAAGGAGCAAGAGAAGGG - Intronic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1048582195 8:135738739-135738761 CTGTATTAGCAGCATAAGAACGG + Intergenic
1048591698 8:135826521-135826543 CTTTATTAGCAGCATGAGAATGG - Intergenic
1048622887 8:136153877-136153899 CTTTATTAGCAGCATGAGAATGG + Intergenic
1048669223 8:136697138-136697160 CTTTATTAGCAGCATGAGAATGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1049968284 9:798852-798874 CTGAGCTGGCAGCAGGAGAAGGG - Intergenic
1050214257 9:3304813-3304835 CTTTATCAGCAGCATGAGAACGG + Intronic
1051017138 9:12491987-12492009 CTTTATTAGCAGCATGAGAATGG + Intergenic
1051160287 9:14200008-14200030 CTCTGTTAGCAGCAGCAGTAAGG - Intronic
1051263809 9:15291511-15291533 CTTTATCAGCAGCATGAGAACGG + Intronic
1051272479 9:15368700-15368722 CTTTATTAGCAGCATGAGAATGG + Intergenic
1051421968 9:16897712-16897734 CTTTATTAGAAGCAGGAGAATGG - Intergenic
1051680051 9:19597939-19597961 CTATGTAAACAGCAGGAGGCAGG + Intronic
1052124149 9:24755107-24755129 CTTTATTAGCAGCATGAGAACGG + Intergenic
1052998685 9:34565464-34565486 CTCAGGCAGCAGCAGGAGAAGGG + Intronic
1053038949 9:34852676-34852698 TTCTGAAAGCAGCAAGAGAAAGG - Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053543592 9:38999486-38999508 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053721093 9:40947267-40947289 CTTTATTAGCAGCATGAGAATGG - Intergenic
1053808022 9:41822991-41823013 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1054344896 9:63904888-63904910 CTTTATTAGCAGCATGAGAATGG + Intergenic
1054622570 9:67364437-67364459 CTGGGTAAGCAGCAGGATAGGGG + Intergenic
1054868443 9:70026463-70026485 CTTTATTAGCAGCATGAGAATGG - Intergenic
1055001876 9:71460381-71460403 CTTTATTAGCAGCATGAGAATGG - Intergenic
1055163741 9:73165117-73165139 CCTTGTATGAAGCAGGAGAAAGG + Exonic
1055170899 9:73256089-73256111 CTTTGTTAGTAGCATGAGAATGG + Intergenic
1055764237 9:79644368-79644390 CTATATTAGCAGCATGAGAACGG + Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1055858607 9:80722616-80722638 ATGTATTAGCAGCATGAGAATGG - Intergenic
1055858657 9:80723105-80723127 CTTTGTTAGCACCATGAGAATGG - Intergenic
1056064310 9:82917270-82917292 CTTTATTAGCAGCATGAGAACGG - Intergenic
1056822951 9:89856415-89856437 CTGTGGAAGCACCAGGCGAGGGG + Intergenic
1057686543 9:97239678-97239700 CTGTGTATGGAGCAGCAAAAAGG + Intergenic
1058086872 9:100757052-100757074 CTGTGTCAGCAGCATGAAAATGG + Intergenic
1058725269 9:107797322-107797344 CTTTATCAGCAGCATGAGAACGG - Intergenic
1058892844 9:109375493-109375515 CTTTATTAGCAGCATGAGAATGG + Intronic
1058998203 9:110320517-110320539 CTTTATTAGCAGCATGAGAACGG + Intronic
1059022987 9:110596767-110596789 CAGTGAAAGCAGCTGGGGAAGGG - Intergenic
1059040811 9:110813803-110813825 CTTTATTAGCAGCATGAGAATGG - Intergenic
1059246061 9:112850682-112850704 CTCTGGAGGAAGCAGGAGAAAGG - Intronic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1059875625 9:118631497-118631519 CTTTATTAGCAGCATGAGAACGG - Intergenic
1060730197 9:126032190-126032212 CTTTATTAGCAGCATGAGAACGG - Intergenic
1060751954 9:126175972-126175994 CTTTATTAGCAGCATGAGAATGG - Intergenic
1061040019 9:128135863-128135885 CTGTGGAAGCACCAGGCGAGGGG - Intergenic
1061332728 9:129906668-129906690 CTTTATTAGCAGCATGAGAATGG + Intronic
1061659127 9:132116632-132116654 CTTTCTGAGCAGCATGAGAATGG + Intergenic
1062214459 9:135381612-135381634 CTCTATTAGCAGCATGAGAACGG + Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203454094 Un_GL000219v1:148883-148905 CTTTATTAGCAGCATGAGAATGG + Intergenic
1203602344 Un_KI270748v1:26083-26105 GTTTGAAAGCAGCAAGAGAAAGG - Intergenic
1185845036 X:3430008-3430030 CTTTATTAGCAGCATGAGAACGG + Intergenic
1186036205 X:5426147-5426169 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186042159 X:5492494-5492516 CTTTATTAGCAGCATGAGAATGG + Intergenic
1186069902 X:5808362-5808384 CTGTATTAGCAGCGTGAGAATGG - Intergenic
1186167306 X:6840327-6840349 CTTTATCAGCAGCATGAGAATGG + Intergenic
1186341966 X:8655059-8655081 CTGGGTGAGGAGGAGGAGAATGG + Intronic
1186449233 X:9658222-9658244 CTGTATTAGCAGCATGATAATGG + Intronic
1186537550 X:10365411-10365433 CTTTATTAGCAGCATGAGAATGG + Intergenic
1187260893 X:17684226-17684248 CTTTATTAGCAGCATGAGAATGG + Intronic
1188397752 X:29705904-29705926 CTTTGTCAGCAGCATGAAAATGG - Intronic
1188438474 X:30189864-30189886 CTGTGCAGGCAGCAGCAGAAGGG - Intergenic
1188629315 X:32332592-32332614 CTGTGAAAGCAGCAGCAAAGGGG + Intronic
1188897737 X:35689776-35689798 CATTGTATGTAGCAGGAGAAAGG + Intergenic
1189202842 X:39212495-39212517 CTTTATTAGCAGCATGAGAACGG + Intergenic
1189433207 X:40968071-40968093 CTTTATTAGCAGCATGAGAATGG - Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1191593487 X:62915518-62915540 CTTTATTAGCAGCATGAGAATGG + Intergenic
1191931672 X:66380173-66380195 CTTTATTAGCAGCATGAGAATGG - Intergenic
1191986616 X:66988012-66988034 CTGTGAAAGCAGCCAGGGAATGG - Intergenic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1192334851 X:70209938-70209960 CTTTATTAGCAGCATGAGAACGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1192508335 X:71704958-71704980 CTTTATTAGCAGCAAGAGAACGG + Intergenic
1192518361 X:71776595-71776617 CTTTATTAGCAGCAAGAGAACGG - Intergenic
1192527056 X:71856075-71856097 CTTTATTAGCAGCAAGAGAATGG + Intergenic
1193209022 X:78783618-78783640 CTTTGTTAGCAGCATGAAAATGG + Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193789443 X:85800532-85800554 CTATGTAAGGAGCAGGAAATGGG + Intergenic
1194113221 X:89864096-89864118 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1194339924 X:92695012-92695034 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1194455970 X:94104203-94104225 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1194659844 X:96618639-96618661 CTTTATTAGCAGCATGAGAATGG - Intergenic
1194756468 X:97744451-97744473 CTTTATTAGCAGCATGAGAATGG + Intergenic
1194952539 X:100144374-100144396 CTTTATTAGCAGCATGAGAACGG + Intergenic
1195536198 X:106011975-106011997 CTTTATTAGCAGCATGAGAACGG + Intergenic
1195929579 X:110061022-110061044 CTCTGTAGGCAGCTGGACAAGGG + Intronic
1196610582 X:117710013-117710035 CTGTATAAGCACCATGAGAGAGG - Intergenic
1196714116 X:118794743-118794765 CTTTGTAAGCAGCACTTGAAGGG + Intergenic
1196760646 X:119197913-119197935 CTTTATTAGCAGCATGAGAACGG + Intergenic
1197025870 X:121749055-121749077 CTTTATTAGCAGCATGAGAACGG + Intergenic
1197507611 X:127327334-127327356 CTTTATTAGCAGCATGAGAATGG - Intergenic
1198024137 X:132688385-132688407 CTTTATTAGCAGCATGAGAATGG - Intronic
1198452990 X:136786481-136786503 CTTTATTAGCAGCATGAGAATGG - Intergenic
1198477010 X:137004899-137004921 CTGTATCAGCAGCGTGAGAATGG - Intergenic
1198919183 X:141707096-141707118 CTTTATTAGCAGCATGAGAACGG - Intergenic
1199124673 X:144102421-144102443 CTGAGAGAGAAGCAGGAGAATGG - Intergenic
1199225732 X:145370994-145371016 CTGAGTTGGCAGCAAGAGAAAGG + Intergenic
1199325654 X:146494718-146494740 CTTTGTCAGCAGCATGAAAATGG + Intergenic
1199346338 X:146745851-146745873 CTTTATTAGCAGCATGAGAATGG - Intergenic
1199751409 X:150823179-150823201 CTTTATTAGCAGCATGAGAATGG + Intronic
1200465906 Y:3519155-3519177 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1200648310 Y:5811795-5811817 CTTTGTTAGCAGCATGAGAATGG - Intergenic
1200791261 Y:7301638-7301660 CTTTATTAGCAGCATGAGAATGG - Intergenic
1200944775 Y:8824068-8824090 CTTTGTCAGCAGCATGAAAATGG - Intergenic
1201143775 Y:11050432-11050454 GTGAGGAAGCTGCAGGAGAAAGG + Intergenic
1201344809 Y:12971271-12971293 ATGTGTTATCAGCAGGTGAATGG - Intergenic