ID: 981595808

View in Genome Browser
Species Human (GRCh38)
Location 4:146420522-146420544
Sequence CCTGAGAGGAAGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 3, 2: 6, 3: 50, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981595804_981595808 0 Left 981595804 4:146420499-146420521 CCAGAGTTTGCTTCAAAATAATA 0: 1
1: 0
2: 3
3: 38
4: 373
Right 981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG 0: 1
1: 3
2: 6
3: 50
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981595808 Original CRISPR CCTGAGAGGAAGAAAGTGGA TGG Intronic
900483782 1:2911836-2911858 TCTGAGAGGAGGAAGGGGGAGGG + Intergenic
901193153 1:7424643-7424665 ACTGAGAGGAAGGAAGGAGAGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901765809 1:11499333-11499355 CCTTAGAAGAAGAAAGCTGATGG - Intronic
902005547 1:13229178-13229200 CCTGAGTGGAAGACAGGGAAGGG - Intergenic
902024867 1:13375455-13375477 CCTGAGTGGAAGACAGGGAAGGG - Intergenic
902088754 1:13885017-13885039 CCTGAGAGGCAGAGATTGTAGGG - Intergenic
902449105 1:16485379-16485401 GCTGGGAGGAAGAAATGGGATGG + Intergenic
902505639 1:16937902-16937924 GCTGGGAGGAAGAAATGGGATGG - Intronic
903154626 1:21435562-21435584 GCTGTGAGGAAGAAATGGGATGG - Intergenic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903919715 1:26790963-26790985 CCTGAGAGGTGGAAAGGAGATGG - Intronic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904919954 1:33999276-33999298 CCTGAGATGAACAAAGAGGCAGG + Intronic
905007910 1:34725823-34725845 CCTCTGAGCAAGAAAGTGGCAGG - Intronic
905096355 1:35474610-35474632 CCTGACAGGAAGTCAGAGGAGGG + Intronic
905601355 1:39254575-39254597 CTTGAGAGGAAGAATGTTCACGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906219688 1:44068995-44069017 CCTGAGAGGAGGCATGTGGCTGG - Intergenic
906935968 1:50214374-50214396 CCCGTGAGTAAGAACGTGGATGG - Intergenic
906949651 1:50323799-50323821 CCAGAGAGGAAGAACGGTGAGGG - Intergenic
907014880 1:51002842-51002864 AGTGAGAGGAAGAGAGGGGAGGG + Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
908116225 1:60943041-60943063 CATGAGAGGAAGACACTGCATGG + Intronic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
908650913 1:66332227-66332249 CCTCTGAGGAAGAAGGCGGAGGG - Intronic
910182247 1:84497764-84497786 CATGAGAGGAATAAAATGGTTGG + Exonic
910434203 1:87188625-87188647 CTTGAAAGGAAGAATCTGGATGG - Intergenic
912208119 1:107530725-107530747 CCTGGCAGGAAGACAGTGCAGGG - Intergenic
912454984 1:109791302-109791324 CCTGTGAGGTAGATAGGGGAGGG - Intergenic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
913121695 1:115748359-115748381 CCAGAGAGAAAGAAAGAGGCTGG - Intronic
913509312 1:119547805-119547827 AAAGAGAGGAAGAAATTGGATGG + Intergenic
914882847 1:151560910-151560932 CCTGAAAGGAAAAACGTGGTAGG - Intronic
915502688 1:156330226-156330248 CCTGGAAGGATGAAAGAGGAGGG - Intronic
915972331 1:160363389-160363411 CCTGAGAGGTAGATCGTTGAGGG - Intergenic
916055687 1:161067843-161067865 ACAGAGAGGTGGAAAGTGGAAGG - Intronic
916519825 1:165553654-165553676 CCTGAGAGGACAGAAATGGATGG + Intronic
917089764 1:171341391-171341413 CCTGAGAGGAAAAAAGAGGGAGG - Exonic
917493449 1:175518395-175518417 CATGAGAGGAGGAATGGGGATGG - Intronic
918602890 1:186384258-186384280 CCAGAGAGGAAGCAAGGGGTTGG + Intronic
918708624 1:187700192-187700214 CCAGGGCTGAAGAAAGTGGAGGG + Intergenic
918848348 1:189648520-189648542 CATGAGAGGAAAAAAGTAAAGGG + Intergenic
919775943 1:201194101-201194123 CCCAGGAGGAAGAAGGTGGAAGG + Intronic
919938194 1:202268714-202268736 TTTGAGAGGAAGAAAGAGGCTGG - Intronic
920119924 1:203648749-203648771 CCAGAAAGGAGGAAGGTGGAGGG - Intronic
920672264 1:208013579-208013601 ACTGAGAGAAGGAAAGTGGCAGG - Intergenic
920865137 1:209745790-209745812 CCTGAGGGGAAGAAATTGGAAGG + Intergenic
921089431 1:211829918-211829940 GGTGAGAGGAAGAAAGTAGGGGG + Intronic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
922331364 1:224579762-224579784 CCAGAGAGGAAGAAAGAGAGAGG - Intronic
922332792 1:224592372-224592394 CCTAAGAGGTAGAAAAAGGAAGG + Intronic
922784460 1:228276181-228276203 GCTGAGGGGAAGAGAGAGGAGGG + Intronic
922816576 1:228453416-228453438 CAGGAGAGGAAGAAATTGCAGGG + Intergenic
924941044 1:248812618-248812640 CCTGAGAGGAAGGCTCTGGAAGG - Intronic
1062999843 10:1906129-1906151 CCTGAAAGGAAGAAAGAAGGAGG + Intergenic
1063201982 10:3792936-3792958 ACTGAGAGAAAGAAAGGGGAAGG + Intergenic
1063903901 10:10763559-10763581 GCAGAAAGGAAGAAAATGGAAGG + Intergenic
1064316398 10:14261762-14261784 CCTGAGAGGGAGAGACAGGAGGG + Intronic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064621390 10:17221334-17221356 CCTTAAAGGAATAAAGTAGATGG - Intergenic
1064676534 10:17765598-17765620 TCTGAAAGGGAGAAATTGGAAGG + Intronic
1064940460 10:20728812-20728834 CCTGAGATGAAAACAGTGAATGG + Intergenic
1066379252 10:34887376-34887398 CCTGGGAGGAAGAAACTGATTGG - Intergenic
1066525889 10:36279238-36279260 CCTCAGAGGAACAAAATGGTGGG + Intergenic
1066616039 10:37295796-37295818 GCTGAGAGGAAGCACTTGGACGG + Intronic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067204318 10:44200321-44200343 CTTCAGAGGAAGAGAGTGGGAGG - Intergenic
1067841213 10:49680768-49680790 CCTGAGAGGATGGAGGTGGGAGG + Intronic
1068590392 10:58846940-58846962 ACTGAGAGTCAGGAAGTGGAAGG + Intergenic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069322310 10:67187381-67187403 CCAGAGTGGTAGAAAGTGTATGG - Intronic
1069915259 10:71783216-71783238 TCTGGCAGGAAGAAAGTTGAGGG - Intronic
1070261886 10:74864518-74864540 CCTGAGGGGAAAAAAGTGGATGG - Intronic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070917339 10:80163405-80163427 CCTGAAAGGAAGCAGGTGTATGG + Exonic
1072255925 10:93620317-93620339 GCTAAGAGGAAGAGAGGGGAAGG - Intronic
1072606778 10:96990720-96990742 ACAGAGAGGAGGTAAGTGGAAGG - Intergenic
1072914134 10:99526850-99526872 CCTGAGAGCATCAGAGTGGAGGG + Intergenic
1073543926 10:104333621-104333643 CCAGAGAGGAAGGAAGGGTAAGG - Exonic
1073755109 10:106572972-106572994 CCTGATAGGAAGGAGGTGCATGG + Intergenic
1074060910 10:109964746-109964768 CAGGACAGCAAGAAAGTGGAAGG + Intergenic
1074733372 10:116401275-116401297 ATTGCAAGGAAGAAAGTGGAAGG + Intergenic
1074869992 10:117568803-117568825 ACTGAGGCCAAGAAAGTGGAGGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075415401 10:122258800-122258822 CATGAGAGAAAGTAAGTGCAAGG - Intergenic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1075904061 10:126065292-126065314 CCTCAGAGGAAGAAGAAGGAGGG + Intronic
1076168722 10:128302826-128302848 CTATAGAGGAAGAAAGTAGAGGG - Intergenic
1077199029 11:1296393-1296415 TCTGAGGGGAAGAGAGAGGATGG + Intronic
1077388811 11:2289737-2289759 CCATAGAGACAGAAAGTGGATGG + Intergenic
1078283151 11:9923078-9923100 CGAGGGAGGAAGAAAGAGGAGGG - Intronic
1078699825 11:13669213-13669235 CTGGGGAGGAAGAAAGTGGTGGG + Intronic
1078883127 11:15472844-15472866 CCAGAGAGGAAGAAAAGAGAGGG - Intergenic
1078888906 11:15535671-15535693 CCTGAGGGGAAGCGAGAGGAAGG - Intergenic
1080247505 11:30196220-30196242 CCTGAGAGGTAAGAAGAGGAGGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1080970569 11:37270484-37270506 CCTGTGAGGAAGTGAGTGGATGG + Intergenic
1081380621 11:42410119-42410141 CCTGAGAGGACCAAAGGGCATGG + Intergenic
1081556463 11:44167020-44167042 CCTGAGAGGAAGAAAGCACTTGG + Intronic
1081599671 11:44484344-44484366 CCTGAGGGGAAGAAAGAGCAGGG + Intergenic
1081715756 11:45248957-45248979 CCTGAGAGAAAGAGAGGGGCAGG - Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1084021878 11:66422612-66422634 GCTGAGAGAGAGACAGTGGATGG - Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084750586 11:71202261-71202283 CCTGAGGGGAGGAATGAGGAGGG - Intronic
1085119931 11:73960625-73960647 CTTCTGAGGAAGAAAATGGAGGG - Intronic
1085309207 11:75506303-75506325 CCAGGGAGGAAGAAGGAGGAGGG + Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1086463796 11:87033200-87033222 GCTGAGAGTAAGAAAGCTGATGG - Intergenic
1086490202 11:87351914-87351936 CCAAAGAGGAAGAAAGAGGAAGG - Intergenic
1087483261 11:98729181-98729203 CATGAGAGGAAGCATTTGGATGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088677486 11:112209248-112209270 GCTGAGAGGAGGAAAGGGGAAGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089940466 11:122411137-122411159 CCCGAGAGGATGACAGGGGAGGG - Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090093370 11:123720123-123720145 CATAAGATGAAGAGAGTGGATGG - Intergenic
1090435876 11:126685982-126686004 CCTGAGAAGAAGCAGGTGAAGGG - Intronic
1090679129 11:129034502-129034524 CCAGAAAGAAAGAAAGAGGAGGG - Intronic
1090697968 11:129267865-129267887 TGAGAGAGGAAGCAAGTGGAGGG + Intronic
1091681858 12:2533102-2533124 CTTGAGAGGAAGGATCTGGAGGG + Intronic
1091694442 12:2618354-2618376 CCCGGGAGGAGGCAAGTGGACGG + Intronic
1092672913 12:10883431-10883453 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1092672971 12:10884076-10884098 CTATAGAGGAGGAAAGTGGAGGG - Intronic
1093223419 12:16450511-16450533 GCTGAGAGGTAGAAAGTGTAAGG + Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1094487013 12:30933481-30933503 GCTGAGAGGAAGGAGCTGGAAGG - Intronic
1095866653 12:46979671-46979693 CCTGTGAGAAAGAAAAGGGAAGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097318781 12:58202504-58202526 CCTGAGAGCTAGAGAGTCGATGG + Intergenic
1099567181 12:84266861-84266883 CATGAGAAGAAAAGAGTGGATGG + Intergenic
1099652420 12:85445287-85445309 CCCTGGAGGAAGAGAGTGGAAGG - Intergenic
1100674536 12:96852162-96852184 TCTAAAAGGAACAAAGTGGAGGG + Intronic
1101828384 12:108238626-108238648 CTTGTGAGGGAGAAAGTGCATGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102193469 12:111007034-111007056 GGAGAGAGGAAGAAAGTGCAAGG + Intergenic
1102757006 12:115349677-115349699 CCTGTGAGGAAGAAAATGCAGGG - Intergenic
1102782412 12:115576539-115576561 AATGAAAGGAAGACAGTGGAGGG - Intergenic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103477239 12:121227650-121227672 CTTGAGGGGAAGAACCTGGAAGG + Intronic
1103729821 12:123020030-123020052 CCTGCGAGGCAGGAAGTGGCAGG + Intronic
1104041627 12:125134620-125134642 CCTGAGAGGGAGAAAGAGCCGGG + Intronic
1106706893 13:32290485-32290507 CCTGATGGGAAGAAAGAGAAAGG + Intronic
1108094864 13:46890952-46890974 ACTAAGAGCAAGAAAGTGAAGGG - Intronic
1108360892 13:49667086-49667108 CGTGAGAGGAAGGTAGGGGACGG + Intronic
1108518338 13:51222749-51222771 CCCGGGGGGAGGAAAGTGGAAGG + Intronic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1111074819 13:83220333-83220355 CCTGAAAGGAAGGGAGTGGTAGG - Intergenic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1112958808 13:105095840-105095862 CCTTAGAGGTAGAAAGAGAAGGG + Intergenic
1113106279 13:106775054-106775076 CCTGGGAGGAAGAGAGTGGGAGG - Intergenic
1113248712 13:108427914-108427936 CCAGAGATGAAGACAGTGTAAGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1114472385 14:22972807-22972829 CCTGAGAGGTAGCAAGTCTAGGG - Exonic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1118061095 14:62138555-62138577 ACTGATAAAAAGAAAGTGGAGGG - Intergenic
1118123117 14:62868215-62868237 CCTGGTGGGAAGAATGTGGAAGG - Intronic
1118195598 14:63622814-63622836 GATGAGAGGAGGGAAGTGGAAGG + Intronic
1118602892 14:67482737-67482759 CCAGAAGGGAAGCAAGTGGAGGG + Intronic
1118710899 14:68518574-68518596 CCTGAGGGGATGAAAGTGGATGG - Intronic
1119443527 14:74645807-74645829 CTTGAGAGGAAGTAAGGGGGTGG - Intergenic
1119866189 14:77977053-77977075 CTTGAGTGGAAGCAAGAGGATGG - Intergenic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120025486 14:79578927-79578949 ATTGAGAGGAAGAAAGTAGAGGG - Intronic
1120329609 14:83074523-83074545 CCAGAGAGCAAGAAAGAGGGGGG + Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1122124477 14:99571686-99571708 CCTTAGAGAAAAAAAGTGGCTGG + Intronic
1122124531 14:99571953-99571975 CCTCAGGGGAAGGAACTGGAGGG + Intronic
1122317340 14:100833980-100834002 CCCACGAGGAAGAATGTGGAAGG + Intergenic
1124195861 15:27628288-27628310 CAAGAAAGGAAGAAAGTGAATGG + Intergenic
1124383954 15:29190612-29190634 CCTGACAGGAAGCAAGTAGTTGG + Intronic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1125832207 15:42725063-42725085 CCTGAAAGGAAGCAAGTGATGGG - Intronic
1126538999 15:49801639-49801661 CCTGAAGGGAAGCCAGTGGAGGG - Intergenic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1127624367 15:60765657-60765679 GCAGTGAGGAGGAAAGTGGAAGG - Intronic
1127760185 15:62131922-62131944 CCTGGGAGGATGAAAGTAGGAGG + Intergenic
1128081064 15:64857140-64857162 GCAGAGAGGAAAAAAGTGGGAGG - Intronic
1128790491 15:70429958-70429980 CCCTGGAGGAAGAAAGAGGAGGG + Intergenic
1128796100 15:70467820-70467842 ACATAGAGGAAGAAAGTGGGTGG + Intergenic
1129771723 15:78207102-78207124 CCTGGGAGGATGAACGTGGGAGG + Intronic
1130176467 15:81576815-81576837 CTTGAGAGGAAGAAGGTGACTGG + Intergenic
1130691634 15:86086373-86086395 CCTGAAATAAAGAAAGTGGAGGG + Intergenic
1131258645 15:90877243-90877265 CCTTAGTGGAAGAAAGGAGAAGG - Intronic
1131812201 15:96184304-96184326 CATGATAGGAAGTAAGTGCAAGG + Intergenic
1132029356 15:98427660-98427682 GCTAAGAGGGAGAAAGTGGGCGG + Intergenic
1132154464 15:99485911-99485933 CCAGAGAGGAAGGAAGTGCTGGG + Intergenic
1132234595 15:100209748-100209770 CCAGCGTGGCAGAAAGTGGATGG + Intronic
1132720207 16:1312046-1312068 CCAGACAGGGAGAAAGTGGGGGG - Intronic
1133971551 16:10571760-10571782 ACTGAGATGAAGAGAGGGGATGG + Intronic
1134120886 16:11584477-11584499 ACTGAGAGGAAGGAGCTGGAAGG - Intronic
1134369920 16:13613671-13613693 CCTGAGAGGCAGAAAGCCAATGG + Intergenic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134425621 16:14141107-14141129 CCGGAGATGGAGAAAGTGGGAGG - Intronic
1134439016 16:14286359-14286381 CCTGTGCAGAAGAATGTGGATGG - Intergenic
1134674430 16:16079440-16079462 GCTGAGATGGACAAAGTGGAGGG + Exonic
1135168485 16:20162366-20162388 CCAGGGAGGAAGAAAGAGGAAGG + Intergenic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1136111668 16:28067361-28067383 CATGAGCTGAAGACAGTGGATGG + Intergenic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1137367489 16:47873402-47873424 ACAGAGAGAAAGAAAGAGGAAGG - Intergenic
1137408468 16:48208322-48208344 CCTGTGAGGAAGAAAGCAGTGGG + Intronic
1137550454 16:49434005-49434027 CTAGAGACGATGAAAGTGGAAGG + Intergenic
1137814253 16:51383340-51383362 CCAGATAGGAAGAATGTGGTAGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138895567 16:61199547-61199569 CATGAGAGGAAGCCAGTGGGAGG + Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1141192491 16:81834651-81834673 CCTGAGAGGAAGATTCTGGTAGG + Intronic
1141570799 16:84932565-84932587 TGGAAGAGGAAGAAAGTGGAAGG + Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142546387 17:706757-706779 CCTGAGGGCATGAAAGTAGAGGG - Intronic
1143141405 17:4743745-4743767 CCTGAGAGGATGAAAGAAGGAGG - Exonic
1143298459 17:5889382-5889404 CTTGAGAGGAAGAGAATCGAAGG + Intronic
1143645792 17:8229206-8229228 CCTGGGATGAAGACAGTGGTTGG + Exonic
1145009124 17:19357422-19357444 GCTCAGATGAAGAAAGTTGAGGG + Intronic
1146579506 17:34024403-34024425 CCTAAAAGGAAGAAAGAGAAGGG - Intronic
1146600059 17:34206267-34206289 TCTGGGGGTAAGAAAGTGGAAGG - Intergenic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147316888 17:39625315-39625337 CCTGAAAGGAAGAAGGGGTATGG - Intergenic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147450725 17:40502266-40502288 CCTGAGGGGAGGACATTGGAGGG + Intergenic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1148018106 17:44536733-44536755 CCTGGGAGGAAGGAATTGAATGG - Intergenic
1148217937 17:45844075-45844097 ATGGAGAGGAAGAAAGTGAAGGG - Intergenic
1149455025 17:56780740-56780762 GCTGAGAGGAAGGAAGGGGGTGG + Intergenic
1149481057 17:57003414-57003436 CCAGAAAGGAGGAAAGTAGATGG + Intronic
1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG + Intronic
1150824999 17:68466485-68466507 CCTGGGAGGCAGAAATTGCAGGG - Intergenic
1151792264 17:76314668-76314690 CTTGATAGGAAAAAAGTGTAAGG - Intronic
1152468678 17:80478790-80478812 CCGCAGAGGAAGGGAGTGGACGG + Intergenic
1152580168 17:81162286-81162308 CCTGAGAGGAAGTAGGGGGATGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153365266 18:4248689-4248711 TCTGAGAGGGAGAGATTGGAAGG - Intronic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1154124399 18:11676782-11676804 CCTGAGAGTAAGAAATGGGTGGG + Intergenic
1154955767 18:21253105-21253127 CCTGAGAGGAAAACACTGCAGGG + Intronic
1155721601 18:29020143-29020165 CCTACGAGGAAGAAAGTAGAAGG - Intergenic
1156613274 18:38752318-38752340 CATGAGGGGGAGAAAGTGTAGGG + Intergenic
1156732221 18:40207750-40207772 CTTGAGAGAAAAGAAGTGGATGG - Intergenic
1156985299 18:43343907-43343929 ACTGAGAGGAATAAAGTAAAAGG - Intergenic
1157621697 18:49020790-49020812 CCTGGGAGGATGTCAGTGGAGGG - Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158453591 18:57587600-57587622 CCTGAGAGGGAAAAAGAAGAGGG - Intergenic
1159548721 18:69872613-69872635 ACTGAGAAGAAGGAATTGGAGGG - Intronic
1159591502 18:70340057-70340079 CCTGAGCCAAAGAATGTGGATGG - Intronic
1159808111 18:72980337-72980359 ACTTACAGGAAAAAAGTGGAAGG - Intergenic
1160798468 19:956433-956455 TCTCGGAGGAAGAACGTGGAGGG + Intronic
1161037103 19:2091056-2091078 CCTGTGGGGAAGAAAAGGGAGGG + Intronic
1162017131 19:7851905-7851927 CCTCAGGGGAACAGAGTGGATGG - Intronic
1163234089 19:16020989-16021011 CCTGACAGGATCAAACTGGAAGG - Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165057402 19:33186591-33186613 CAAGAGAGGAAGGAAGTGGGAGG + Intronic
1165139947 19:33692919-33692941 CATGAAAGGAGGGAAGTGGATGG - Intronic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1166106317 19:40599880-40599902 CCTGAGAGAAAGAGAGATGATGG - Intronic
1166648137 19:44547950-44547972 ACTGAGATTAAGAAAGGGGAAGG - Intergenic
1168162263 19:54519211-54519233 CCAGAGAGGAAAAGAGGGGAAGG + Intergenic
924961056 2:35036-35058 TCTGACATGAAGTAAGTGGATGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925422197 2:3721703-3721725 CATGAGAGGAACCAAGTGGGAGG + Intronic
925462030 2:4071954-4071976 ACTGAGTGGAGGAAACTGGAAGG + Intergenic
926715753 2:15922243-15922265 CAAAAGAGGAAGGAAGTGGACGG + Intergenic
927313368 2:21654790-21654812 CCTGGCAGGAAGAGAGGGGATGG + Intergenic
927326157 2:21807743-21807765 CCTGAAACAGAGAAAGTGGAGGG - Intergenic
928367944 2:30717143-30717165 ACAGAGAGGACGAAAATGGAAGG - Intergenic
929124519 2:38511068-38511090 CCTTGGAAGAAGAAAGTCGAGGG + Intergenic
929261269 2:39869144-39869166 GCAGAGAGCAAGGAAGTGGATGG - Intergenic
929783104 2:44970561-44970583 CGTGAGCGGAGGAAGGTGGAAGG + Intergenic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
929846211 2:45530979-45531001 TCTGTGATGAAGAAAGTGGGTGG - Intronic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
931888285 2:66642316-66642338 ACAGAAAGAAAGAAAGTGGAAGG - Intergenic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
932145555 2:69313000-69313022 CCACAGAGGTAGAAACTGGAGGG - Intergenic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933833992 2:86231398-86231420 GCTGAGAGGGAGGAAATGGACGG + Intronic
933969688 2:87460345-87460367 GAAGAGAGGAAGGAAGTGGAGGG + Intergenic
935421076 2:102869479-102869501 CCAGAGAGGAAGAAGGGGAAAGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936780999 2:116032129-116032151 CCTGAGATGAAGACACTGAATGG + Intergenic
936893061 2:117394724-117394746 TCAGAGAGGAAGAAAATGGTAGG + Intergenic
937446115 2:121959643-121959665 CCTGGGAGGTAGACAGGGGAAGG + Intergenic
937535108 2:122876677-122876699 CCTGAAAGGAAGAAAGCAGAGGG - Intergenic
937536523 2:122895623-122895645 TCTGAGAGGTAGAAAGTCAATGG + Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
939364759 2:141217261-141217283 ACTAGGAGCAAGAAAGTGGAGGG - Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941446255 2:165603507-165603529 GAGGAGAGGAAGGAAGTGGAAGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
942370626 2:175280532-175280554 CTTGAAAGAAAGAAAGTGGCCGG + Intergenic
943219605 2:185088954-185088976 CCTGGGAGGAAACAAGTGGGAGG + Intergenic
944237252 2:197451936-197451958 AGTGAGAGGAGGAAAGTGGTAGG - Intergenic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
945324024 2:208462422-208462444 CCTGGGAATAAGAATGTGGAAGG + Intronic
946447725 2:219754109-219754131 CATGGGAGGAAGCTAGTGGAAGG + Intergenic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
947044968 2:225971387-225971409 CCTGAGAAGGAGAAAGTTAATGG + Intergenic
947602518 2:231463495-231463517 CCTGGGAGGAAAAATGTGGGCGG - Intronic
1168907107 20:1414857-1414879 ACAAAGAGGAATAAAGTGGAAGG + Intergenic
1169300151 20:4435228-4435250 GGTGAGAGGAAGAAAGAGAAAGG + Intergenic
1169524266 20:6406314-6406336 CCTGAGAAGAATAAAGTTGGAGG - Intergenic
1169636781 20:7701065-7701087 CCAGAGAGGAAGAGCTTGGAGGG + Intergenic
1169957955 20:11126823-11126845 TGTGAGAGGGTGAAAGTGGAAGG - Intergenic
1170959424 20:21012077-21012099 CCAGAGAGGAAGCGAGGGGAGGG - Intergenic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1172156124 20:32826163-32826185 GCTGAGAGGAAGAAACAGGGTGG - Intronic
1172231820 20:33341811-33341833 CCTGGCAGGGAGAAAGTGCAGGG + Intergenic
1172783017 20:37448266-37448288 TAGGAGAGGAAGAAAATGGAAGG - Intergenic
1172898490 20:38316996-38317018 GGGGATAGGAAGAAAGTGGAAGG + Intronic
1172903100 20:38349204-38349226 CCTGTGTAGAAGAAACTGGAAGG - Intronic
1173132558 20:40408373-40408395 CCTCAGAGGAAGAACCTGGGTGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173449246 20:43147929-43147951 CCTGATAGGAAGAATCTAGATGG - Intronic
1173826680 20:46052105-46052127 CCTGGGAGGAACACAGTGCAGGG + Intronic
1173830306 20:46079807-46079829 TTTGTGAGGAAGAAAGTGGGGGG + Intronic
1174197932 20:48786407-48786429 CAGGAGAGAAAGAAAGTGGCGGG + Intronic
1174444012 20:50578317-50578339 TCTTAGAGGTAGAGAGTGGAAGG + Intronic
1174595618 20:51681075-51681097 CCTGGGAGGAGGAGAGTGGAAGG - Intronic
1175328938 20:58149421-58149443 TCTGGGAGGAAATAAGTGGATGG - Intergenic
1175390812 20:58626172-58626194 CCAGAGAGGAAGGAAGTGAAGGG + Intergenic
1175396039 20:58662387-58662409 TCTGAGGGGAAGAAAAAGGAGGG - Intronic
1176312037 21:5156567-5156589 ATTTAGAGGAAGAAAGTGAAGGG - Intergenic
1176517854 21:7799678-7799700 CATGTGAGGAAGAGAGAGGAAGG + Intergenic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1178036226 21:28586081-28586103 TCTGGGAGCAAGAAAGTGGTGGG + Intergenic
1178651882 21:34429691-34429713 CATGTGAGGAAGAGAGAGGAAGG + Intergenic
1179014592 21:37585019-37585041 CCTGACAGGTCGAAAATGGAAGG - Intergenic
1179187543 21:39096549-39096571 CCCCAGAGGAAGAAACTTGAGGG + Intergenic
1179398020 21:41059158-41059180 CCTTATAGGAAGAAAGTAGGAGG - Intergenic
1179468097 21:41591434-41591456 GCTCATAGGAAGCAAGTGGATGG - Intergenic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1179845011 21:44105463-44105485 ATTTAGAGGAAGAAAGTGAAGGG + Exonic
1179952130 21:44714305-44714327 CGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1180630082 22:17222775-17222797 CCTGGCAGCAAGAAAATGGAAGG + Intergenic
1181262957 22:21611870-21611892 CTTGAGAGGCTGCAAGTGGAGGG + Intronic
1181483420 22:23215729-23215751 CCTAAGTGGAACTAAGTGGAAGG + Intronic
1182153704 22:28049409-28049431 CCTCACAGGAAGAAAGTTTAAGG - Intronic
1182295490 22:29309458-29309480 CCTGGGAGGCAGATAGCGGATGG + Intronic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1184049629 22:41994819-41994841 GTTGAGAGGAAGAAGGTGGTTGG - Intronic
949743044 3:7258434-7258456 CAAGAGAGGAAGAGAGTGGTAGG + Intronic
951005360 3:17609646-17609668 CCTCAGAGGATGATAGTTGAAGG - Intronic
951823446 3:26840505-26840527 CTGGGGAGGAAAAAAGTGGAGGG - Intergenic
952234398 3:31463941-31463963 GCTGAAAGGTAGAAAGTGGAAGG - Intergenic
952750128 3:36818093-36818115 ACTGAAAGGAGGAAAGTGGTGGG + Intergenic
952774042 3:37027682-37027704 CATGGGAGAAGGAAAGTGGAGGG - Intronic
954147249 3:48640561-48640583 TGTGAGAGGAAGAAAATGGGGGG + Intronic
955756227 3:62227752-62227774 CCTGAGAGGAAGAGAGGAGCAGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956426272 3:69138970-69138992 TCTGTGAGGACAAAAGTGGAAGG + Intergenic
957652098 3:83020873-83020895 TCTGAGAGAAATAAAGAGGAAGG - Intergenic
957874362 3:86126676-86126698 GTTGAGAGGAAGAAACTGAATGG + Intergenic
958936430 3:100260890-100260912 CCAGAGGGGAAGAAAGAGGGAGG - Intergenic
959392476 3:105793255-105793277 CCTGAGAGAAGGAAAGTGAAAGG + Intronic
959548775 3:107630010-107630032 GCTCAGAGGACTAAAGTGGAGGG - Intronic
960886995 3:122405964-122405986 CCTGTGAGGCAGCATGTGGACGG - Intronic
961449173 3:126994802-126994824 CCTGAGAGCAAGAAGGAGGCAGG - Intronic
961495165 3:127286177-127286199 CCAGAGAGGGAGAAAGAGAAAGG + Intergenic
961529273 3:127530225-127530247 CCAGAAAGGAAGAAAGATGAGGG + Intergenic
961545067 3:127627791-127627813 CCTCAGAGGAGGAAAGAAGAGGG + Intergenic
961560153 3:127723204-127723226 TCAAAGAGGGAGAAAGTGGAGGG - Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962076637 3:132088876-132088898 CATGAGAGTAAGAATGTGGGAGG - Intronic
962268080 3:133957655-133957677 CCTGAGAGGAAGTAGGTGTAAGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
962360917 3:134742112-134742134 AATGAGAGGATGAAAGTTGAAGG - Intronic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
964026797 3:152083594-152083616 CTTGAGAGGAAAAAAAGGGAGGG + Intergenic
964680395 3:159331611-159331633 CGTGAGAGGAAGTAGGGGGATGG - Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965704181 3:171489454-171489476 TCTCAGAGGAAGAAAAAGGAAGG + Intergenic
966211183 3:177454928-177454950 CATGAAGGGAAGAAAGAGGAAGG - Intergenic
966633738 3:182108562-182108584 ACTGTGAGGATGAAAGTGAATGG + Intergenic
966723250 3:183085702-183085724 TCTTACAGGAAGAAAGTGGTAGG - Intronic
966748147 3:183297663-183297685 ACAGAGAGAAAGAAAGAGGAAGG - Intronic
966831781 3:184016645-184016667 CAAGAGAGGAAGAAAGAGAAGGG + Intronic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967274244 3:187758106-187758128 TTGGAGAGGAAGAAAGTGCATGG - Intergenic
969777615 4:9369521-9369543 CCTGTGAAGAAATAAGTGGAAGG + Intergenic
971685505 4:29760959-29760981 CCTCAGAGAAAGAAAGGGGAAGG - Intergenic
972341676 4:38157490-38157512 CAAGAGAGGAAGCAAGGGGAGGG + Intergenic
972565263 4:40263935-40263957 CCTAAGAGCATGGAAGTGGATGG + Intergenic
972770534 4:42193209-42193231 CAGGAGAGGAGGAAAGTGGAAGG - Intergenic
972894595 4:43604172-43604194 TCTGGGAGGAAGAAAGAGCAAGG - Intergenic
973312150 4:48721261-48721283 TCAGAGAGGTAGAGAGTGGAGGG + Intronic
973638877 4:52884402-52884424 CCTGGGAGGATGAGAGTGGAAGG + Intronic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
975136135 4:70876083-70876105 CAAGAGAGGAAGAAAGAGGTGGG - Intergenic
975683785 4:76900018-76900040 CTAGAGTGAAAGAAAGTGGAGGG + Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
976637911 4:87306609-87306631 ACTGAAAGGAAGAGAGTGGCTGG + Intronic
977415227 4:96724009-96724031 CCTGGGAGGAACCCAGTGGAAGG + Intergenic
978859423 4:113430804-113430826 GCTGACTGGAAGAAAGCGGAAGG - Intergenic
979067664 4:116158397-116158419 CATAAGTGGAAGAAAATGGAAGG + Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982360968 4:154518616-154518638 TCAGAAAGGAAGAAAGTGAAAGG - Intergenic
982932146 4:161421866-161421888 CCTGAGAGCTAGAAAGCTGATGG - Intronic
983139514 4:164132190-164132212 CGTGAAACGAAGAAAGAGGAAGG - Intronic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
985137189 4:186798210-186798232 CCTGAGAGCAAGATTATGGATGG + Intergenic
985541105 5:488160-488182 GCTGGGAGGAAGGAGGTGGAGGG + Intronic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986074603 5:4322577-4322599 TCTTAGAGGAAGAAGTTGGAAGG - Intergenic
986890117 5:12293198-12293220 GCCCAGAGGATGAAAGTGGAAGG + Intergenic
987243592 5:16026274-16026296 CCTGAGAACAAGAAAGCTGATGG + Intergenic
988817558 5:34849904-34849926 CCAGAGAGGAAGCAATTGGAAGG + Intronic
988976972 5:36525467-36525489 TAGGAGGGGAAGAAAGTGGATGG - Intergenic
988977281 5:36527754-36527776 TAGGAGGGGAAGAAAGTGGATGG - Intergenic
989071186 5:37513419-37513441 ACTGAAAGGAAGGAAGTGGCTGG + Intronic
990681134 5:58245588-58245610 CCTGAGAGGAAGCAAGATGTGGG - Intergenic
991966454 5:72096289-72096311 GCTGATAGGAAGAAAGCAGACGG - Intergenic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
994452107 5:99955915-99955937 CCTGGGAGGAAGAAAGGGGTGGG - Intergenic
994787475 5:104182487-104182509 CCTGAGTGGAAAAAAATGGCTGG - Intergenic
996028336 5:118676713-118676735 CCACTGAGGAAGTAAGTGGAGGG - Intergenic
997531265 5:134582694-134582716 CCTCTGAGGGAGAAAGTGGCAGG - Exonic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1000875607 5:166633964-166633986 CCTGAAAGAAAGAAAGCGAATGG - Intergenic
1001963416 5:175894216-175894238 GCTGTGAGGAAGGGAGTGGAGGG + Intergenic
1002416657 5:179124357-179124379 GCTGGGAGGAAGAATGAGGATGG - Intronic
1002676303 5:180916111-180916133 CAAGAGAGTAAGAAAGAGGAAGG + Intronic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1002865106 6:1115010-1115032 CAAGAGAGGAAGAAAAAGGAAGG - Intergenic
1003160497 6:3630180-3630202 CCTAAGAGGAGAAAAGTGCAGGG + Intergenic
1003616408 6:7658980-7659002 GCTGAGAAGACGAAAGTCGAGGG + Intergenic
1005952232 6:30640513-30640535 CCTGTGAGGAAGGAAGCGGCGGG - Exonic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006548901 6:34804080-34804102 CCTGAAAGGAAGACAGTGTGGGG - Intronic
1007380783 6:41488825-41488847 GCTGGGAGGGAGAAAGTGGGAGG + Intergenic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1008402540 6:51080172-51080194 ACTGATAGGAAGAAAGTAGAAGG + Intergenic
1009028783 6:58032036-58032058 CCAGGAAGGAAGAGAGTGGAAGG + Intergenic
1009204316 6:60783416-60783438 CCAGGAAGGAAGAGAGTGGAAGG + Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010377504 6:75188742-75188764 CCAAAGAGGAAAAAAGTGGTTGG + Intronic
1010507715 6:76680863-76680885 CATGAGATGAAGTAAGTGGGAGG + Intergenic
1010891640 6:81319878-81319900 CCTCACTGGAAGAAAGTAGAAGG - Intergenic
1011047597 6:83102882-83102904 CCTGAGTGGAATAAACTGGGGGG - Intronic
1011149099 6:84249350-84249372 CCTGAGGGTAAGAGAGTGGAGGG - Intergenic
1011860218 6:91746035-91746057 CCTGGGATGAAGAACTTGGATGG - Intergenic
1011956022 6:93026364-93026386 GCTGAGAAGAAGAAAGATGAGGG - Intergenic
1012472983 6:99591207-99591229 CCTGAGAGGACGGAAAGGGAAGG - Intergenic
1012984931 6:105865738-105865760 CGAGAGTGGAAGGAAGTGGATGG - Intergenic
1013006747 6:106081128-106081150 CCTGAGAGGTGGAGAGGGGAGGG - Intergenic
1013150279 6:107439123-107439145 CTGTACAGGAAGAAAGTGGAGGG - Intronic
1013311657 6:108900385-108900407 GCAAAGAGGGAGAAAGTGGAGGG - Intronic
1013671715 6:112410538-112410560 GCAAAGAGGAAGAAAGTGTAAGG + Intergenic
1014136709 6:117897815-117897837 CCTTAGAGTAAGCAAGTAGAGGG + Intergenic
1015195077 6:130516785-130516807 CAGGAGAGAAAGAAAGTGTAGGG - Intergenic
1015455875 6:133425534-133425556 CAAAACAGGAAGAAAGTGGAGGG - Intronic
1015486572 6:133777224-133777246 ACTTAGTGGAATAAAGTGGAAGG + Intergenic
1016098558 6:140068463-140068485 CCTAAGAGGAAGAAAGAATAAGG - Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017153305 6:151300582-151300604 CCTGTGGAGAAGGAAGTGGATGG + Intronic
1018305179 6:162447585-162447607 CCAGAGAGTAAGGAAGTGAATGG + Intronic
1018396109 6:163379213-163379235 GCTGTGAGGAAGGAAGGGGATGG - Intergenic
1018559713 6:165089065-165089087 TATGAGAGGAAGCATGTGGAGGG - Intergenic
1018787665 6:167121075-167121097 CCAGAGGGGAAGGTAGTGGATGG - Intergenic
1019389425 7:777552-777574 CCAGCGAGGGAGAAAGGGGATGG + Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020451291 7:8323267-8323289 CCTCAGTGGAGGAAAGGGGAAGG + Intergenic
1020830545 7:13089504-13089526 CCTGCCAGGCAGAAAGTGAAGGG + Intergenic
1021491338 7:21222389-21222411 CTTCAGAGAATGAAAGTGGAAGG - Intergenic
1021514344 7:21466465-21466487 CCTCAAAGGAAGAAACTGCAGGG + Intronic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022012791 7:26323519-26323541 GAGGAGAGGAAGAGAGTGGAAGG + Intronic
1022320885 7:29286533-29286555 AATGAGAGGAAGAAAGGGTAAGG - Intronic
1022356057 7:29615630-29615652 CCAGAGAGGAAGACAGAGGTAGG - Intergenic
1022980126 7:35596420-35596442 GGAGAGAGGAAGAAATTGGATGG - Intergenic
1023097957 7:36681958-36681980 TCTGTGAGGGAGAAAGTAGAGGG + Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1024006733 7:45229781-45229803 CCTGGGAGATAGAGAGTGGAGGG + Intergenic
1025151643 7:56559165-56559187 CCAGAGAGGAAGAAAGATGTTGG - Intergenic
1025246746 7:57323303-57323325 CCAGTGAGGAGGAAAGAGGAGGG - Intergenic
1025709116 7:63891256-63891278 CCTGAGTGGAAGACACTGAAGGG + Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026858826 7:73771543-73771565 TCTGAGGGGAAGAGAGGGGATGG - Intergenic
1028363394 7:89996151-89996173 CCTGAGAGGAAACCAGTGGGAGG - Intergenic
1028610119 7:92701165-92701187 CCGGAGAGGATCAAAGTGGATGG + Intronic
1028983159 7:96989496-96989518 CCTGAGATGAAGGTAGTGCAGGG + Intergenic
1029578232 7:101418379-101418401 CCTAAGAGACAGAAAGTAGATGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031172818 7:118313041-118313063 ACTGAGAGGAGGACAGGGGAAGG + Intergenic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032242760 7:130177626-130177648 CAATACAGGAAGAAAGTGGACGG + Intronic
1032546032 7:132743483-132743505 CCTTAGAGTAAGAAGGTGGCAGG + Intergenic
1032906836 7:136377891-136377913 CATAAGAGGAAGAAAGGGCAAGG + Intergenic
1033546109 7:142401644-142401666 CCTGAGAGGAAGAGAGCATAAGG - Intergenic
1033579216 7:142716320-142716342 GCTGAGAGGAAGAAAATAGGAGG - Intergenic
1033591156 7:142809400-142809422 CATGAGTGGAAGGAAGTGGGAGG - Intergenic
1034083437 7:148301868-148301890 TCTGAATGGAAGAGAGTGGATGG + Intronic
1034447746 7:151122174-151122196 CCAGGGAGGAGGAAGGTGGATGG - Intronic
1034996439 7:155580203-155580225 ACAGAGAGGAAGAGACTGGAAGG + Intergenic
1036070266 8:5434697-5434719 CCTGAGATGAAGGAATTAGAGGG - Intergenic
1037525547 8:19720692-19720714 TCTGAGAACAAGCAAGTGGATGG - Intronic
1037891367 8:22625434-22625456 CCAGAGAGGAGGAAAGACGAGGG + Intronic
1038046928 8:23773422-23773444 ACTGAGAGGAAGGAACTGCAAGG - Intergenic
1038978079 8:32723809-32723831 GCTGAAAGGAAGAAAGAAGAAGG + Intronic
1039365364 8:36923075-36923097 CATGAGAGGAGGAACATGGAGGG - Intronic
1039368356 8:36957320-36957342 CCAGAGAGGAAGAAAATTTAAGG - Intergenic
1039919210 8:41881622-41881644 CCTAAGAGGAAAAAAGTGAGAGG - Intronic
1039987687 8:42461768-42461790 AGAGAGAGAAAGAAAGTGGAGGG - Intronic
1041926587 8:63243219-63243241 GCTGAGAGGAAGAAGGTAAAGGG - Intergenic
1042204022 8:66310230-66310252 CCTGAATGGAACAAAGTTGAAGG + Intergenic
1042682573 8:71402252-71402274 TCTGAGAGAAAGCAAGTGGAGGG - Intergenic
1043137111 8:76541997-76542019 TATGTGAGGAACAAAGTGGAGGG - Intergenic
1044597780 8:93975220-93975242 AGTTAGAGGAAGAAAGTGAATGG - Intergenic
1044621926 8:94199002-94199024 TCTGAGAGGAAGAGACTGGCTGG - Intronic
1045353077 8:101360317-101360339 TCCGAGAGGAAGAGAGTGGCTGG - Intergenic
1045430757 8:102112840-102112862 CCAGAGAGGAAGCAAGGGGAGGG - Intronic
1045641574 8:104257293-104257315 TCTCAGAGGAAAAATGTGGATGG - Intergenic
1045697885 8:104831182-104831204 TCTGAAAGAAAGAAAGTGAAGGG + Intronic
1046155853 8:110289353-110289375 AATGAGAGGAAGGAAGTGGGGGG - Intergenic
1046208105 8:111030527-111030549 CAAGAGAGGAAGAAAGAGGGAGG + Intergenic
1046530600 8:115440283-115440305 CCTGAGAAGTAGAAAATGTAAGG + Intronic
1047137117 8:122092001-122092023 TCTGAGAGGAGGAAAGGGGAAGG - Intergenic
1047236627 8:123047460-123047482 TCAGAGAGAAAGAAAGAGGAAGG - Intronic
1048103222 8:131378302-131378324 CCTCAGGGGATGAGAGTGGAGGG + Intergenic
1048132253 8:131710762-131710784 GATTAGAGGAGGAAAGTGGAGGG - Intergenic
1048980709 8:139702310-139702332 CCAGAGAGGTAGTAAGTGTAAGG + Intronic
1049041416 8:140114779-140114801 TGTGAGAGGAAGGAAGTGAAAGG + Intronic
1049493688 8:142918132-142918154 GCTGAGAGGAGTAAAATGGATGG + Intergenic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1050122399 9:2321051-2321073 CATGAGAGGTAGAAAGTGTGGGG + Intergenic
1050610948 9:7352651-7352673 CCTAAGATGAGAAAAGTGGAGGG - Intergenic
1051431478 9:16984739-16984761 CCTGGGAGGAAGGAAGGGCAGGG + Intergenic
1052159971 9:25246068-25246090 CCTGTGAGAAAGAAAGGGAAGGG - Intergenic
1052414820 9:28164818-28164840 CCTGTCAGGAGGAAAGTGCAAGG - Intronic
1052434859 9:28413489-28413511 ACTGAGAGGGAGAAGTTGGAGGG - Intronic
1052825046 9:33167915-33167937 CCTGCGGCAAAGAAAGTGGACGG + Intergenic
1054728423 9:68676292-68676314 CAGGAGAGGAAGCAGGTGGATGG - Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1057045323 9:91881817-91881839 CCTGAGATGAAGAAGGATGAGGG + Intronic
1057408893 9:94799014-94799036 ACGGAGAGTAAGAAAATGGATGG - Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057969142 9:99536637-99536659 CCTGGAAAGAAGAAAGTAGAAGG + Intergenic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1058090814 9:100803588-100803610 GCAGAGAGGAAGAACGTGGAAGG - Intergenic
1058531394 9:105908791-105908813 CAAGAAAGGAAGCAAGTGGAGGG + Intergenic
1058747056 9:108001946-108001968 CTTGAGAGGTAGAAAGAGCAAGG + Intergenic
1060424524 9:123493400-123493422 ACTGAGAGGGTGAAAGAGGATGG + Intronic
1061074707 9:128334012-128334034 CCTGAGAAGAGAGAAGTGGAGGG + Exonic
1061170906 9:128953512-128953534 CCTAAGAGAATGAAAATGGAAGG - Intronic
1062319553 9:135984118-135984140 CCTCAGAGGAGGACAGGGGAGGG + Intergenic
1185472822 X:394888-394910 CCATGGAGGCAGAAAGTGGATGG - Intergenic
1186194680 X:7098774-7098796 TCTGAGAGGGGGAAAGTAGAGGG + Intronic
1186261488 X:7784732-7784754 CCATAGAGACAGAAAGTGGATGG + Intergenic
1187020101 X:15372618-15372640 CCTTAGAGGAAGATAGGTGAGGG + Intronic
1188581915 X:31724221-31724243 CCTGAGAGGAAGATACTGGCTGG + Intronic
1190244694 X:48683586-48683608 CCAGAGAGTAAGAAAGGGGGAGG + Intronic
1192057196 X:67785037-67785059 CATGAGAGTGAGAAAGTGGCAGG - Intergenic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192247720 X:69387529-69387551 TCTCAGAGGAAGAAAGAGGTCGG - Intergenic
1192477903 X:71459432-71459454 CTTGTGAGGCAGCAAGTGGAGGG + Intronic
1192536112 X:71929080-71929102 GCTGAGAGGAAGACAGGGCAGGG + Intergenic
1193370530 X:80691857-80691879 CCAGAGACGAAGAATGTGAACGG - Exonic
1193453743 X:81703059-81703081 TCAGAAAGGAGGAAAGTGGAAGG - Intergenic
1193898481 X:87144961-87144983 CCAGACAGCAAGAAAGTGGGTGG - Intergenic
1194433871 X:93846059-93846081 CCAGAAAGGAAGAAAACGGAAGG - Intergenic
1194767601 X:97860281-97860303 CTTGACAGGAAGAAATTGCATGG - Intergenic
1195513468 X:105744731-105744753 CCTGAGAATAAGGAAGTGGTAGG - Intronic
1196721265 X:118856266-118856288 CCTGAGAGATAAAAAGTGGTTGG + Intergenic
1197962958 X:132025011-132025033 CCTGAGAGGAAGAAAGTTTAAGG - Intergenic
1199893385 X:152110042-152110064 CCTGAGGGAAAGAAGGGGGAAGG - Intergenic
1200066802 X:153507859-153507881 GCTGACTGGAAGAAAGAGGAGGG + Intronic
1201616828 Y:15909685-15909707 CCTCAGAGGAAGCAGGTGAATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic