ID: 981599441

View in Genome Browser
Species Human (GRCh38)
Location 4:146469102-146469124
Sequence GAGGCTAATGGCTTCTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981599435_981599441 2 Left 981599435 4:146469077-146469099 CCAGAAGGAGAGCACAGTCACTG 0: 1
1: 0
2: 2
3: 23
4: 232
Right 981599441 4:146469102-146469124 GAGGCTAATGGCTTCTAGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981599441 Original CRISPR GAGGCTAATGGCTTCTAGGA GGG Intronic
900824762 1:4917504-4917526 CAGGGAAATGACTTCTAGGAAGG + Intergenic
903554178 1:24181089-24181111 GAACCTAATGGCCTCCAGGAGGG + Intronic
905715088 1:40142322-40142344 GAGACTACTGGCATCTAGCAAGG - Intergenic
906892041 1:49727753-49727775 GGGACTATTGGCTTCTAAGATGG - Intronic
909656910 1:78042876-78042898 GAGCCCAAAGGCTGCTAGGAAGG + Intronic
910014867 1:82509689-82509711 AAGGATAATGGATTTTAGGAAGG - Intergenic
910869727 1:91822164-91822186 GATTCTAAAGGCTTCTAGGTGGG - Intronic
912426333 1:109595189-109595211 GAGACTAATGGCTTCTTTGATGG - Exonic
917415944 1:174809356-174809378 GAGGCTAATAGCCTCAGGGAGGG - Intronic
920223220 1:204419644-204419666 GAGGCTATTGTAGTCTAGGAGGG - Intergenic
920508673 1:206534877-206534899 GTGGAGCATGGCTTCTAGGAAGG - Intronic
1063308073 10:4924976-4924998 TATGCTAGGGGCTTCTAGGAAGG - Intronic
1067699864 10:48563063-48563085 GAGGCTGCTGGCTTCGAAGATGG - Intronic
1067718196 10:48705448-48705470 GAGGCTGCTGGCTTGTAGGTGGG + Intronic
1068453998 10:57231665-57231687 GTGGCTAATGGCCCCTAGAATGG + Intergenic
1069079099 10:64069024-64069046 AATGCTACTGGCTTCTAGTAGGG - Intergenic
1069667998 10:70177181-70177203 GAGACTATTTGCTTCTAGGAAGG + Intergenic
1069804941 10:71116168-71116190 CAGGCTGATGGCTTCTCAGATGG + Intergenic
1071157625 10:82709219-82709241 GTGTCTAATGGCTACCAGGAAGG + Intronic
1071376560 10:85011397-85011419 GGGGCAAATGACTTCTAGGGTGG + Intergenic
1073451724 10:103613590-103613612 GAGGTAAATGGCCTGTAGGAAGG + Intronic
1076544321 10:131234493-131234515 GAGGCTCATGGCTTGAAGGCAGG + Intronic
1076702143 10:132279079-132279101 GTTGCTAATTGCTTCTAGAAGGG - Intronic
1077541530 11:3148785-3148807 GAGGCTAAGGGTTTTTAAGAAGG + Intronic
1078028953 11:7728821-7728843 GATGATGATGGCTTCTTGGATGG + Intergenic
1078902781 11:15656836-15656858 GAGGCTAATGGCCTCTGGAAAGG - Intergenic
1080946166 11:36978021-36978043 AAGCATTATGGCTTCTAGGAAGG + Intergenic
1080946537 11:36980662-36980684 AAGCATGATGGCTTCTAGGAAGG + Intergenic
1083272438 11:61579230-61579252 TAAGCTACTGGCTTCTAAGAAGG + Intronic
1083295723 11:61714488-61714510 GATGTTGCTGGCTTCTAGGAGGG + Intronic
1084983058 11:72842718-72842740 GATGATGATGGCTTCTGGGAAGG - Exonic
1105707599 13:22977787-22977809 GAAGCCAATGGATTCCAGGAGGG - Intergenic
1106092500 13:26609916-26609938 GTGGCTAGTGGCTACTAGGTTGG - Intronic
1106906054 13:34409862-34409884 GAGTCTGATTGCTTCTGGGATGG + Intergenic
1107824191 13:44312641-44312663 GGGCCTACTGCCTTCTAGGATGG - Intergenic
1113711813 13:112470076-112470098 GAGTCTCATGTCTTCCAGGATGG - Intergenic
1115858773 14:37660514-37660536 GAGGATAATGGCTTCCAGCCTGG + Intronic
1117203174 14:53413194-53413216 GAGGCTAAGGGCTCATGGGATGG - Intergenic
1119385419 14:74255236-74255258 CAGGCTGGTGGCTTCCAGGAAGG + Intronic
1119437718 14:74609124-74609146 CTGGCTAATGGCTTCTAGTCAGG - Intronic
1119608546 14:76042529-76042551 GAGGCCAAAGGATGCTAGGAAGG - Intronic
1120530134 14:85621975-85621997 GAGGCTAATAGCCTCCCGGAAGG - Exonic
1128710732 15:69869530-69869552 GTGGCTAATCTCATCTAGGAAGG + Intergenic
1132461405 16:56963-56985 GAGGCGTGTGGCTTCTGGGAAGG - Intronic
1138255375 16:55553683-55553705 GTTCCTAATGGCTTCTAGAATGG + Intronic
1145243716 17:21253975-21253997 GTGGCTACTGGCTACTGGGAAGG + Intergenic
1149384497 17:56128213-56128235 AGGGCTATTGGCTTCCAGGAGGG - Intronic
1149579490 17:57739249-57739271 GAGGCCAATGGCTTAGGGGAAGG - Intergenic
1149973136 17:61238798-61238820 CAGGCTTGTGGCTTCTGGGAGGG + Intronic
1152213099 17:79013990-79014012 GACGCTAATGGCTCCAAAGAAGG - Intergenic
1153779822 18:8484742-8484764 GAGGATAAAGGCTACCAGGAAGG + Intergenic
1158164176 18:54520369-54520391 GTTGCTGATGGCTTCTTGGAAGG - Intergenic
1158345074 18:56508084-56508106 GGGGCTAATGGGGTCGAGGATGG + Intergenic
1163195439 19:15716388-15716410 TAGGCTAATTGCTGCTGGGATGG + Intergenic
1166660914 19:44647021-44647043 GAGGGTAAGGGCGTCTGGGATGG - Intronic
1167044751 19:47042967-47042989 GTGGCTAGTGGCTTCTGGAATGG - Intronic
926450067 2:12992419-12992441 GTTCCTAATGGCTTCTAGAATGG - Intergenic
930153015 2:48077629-48077651 GAGGATGATGGCTTCAGGGAAGG - Intergenic
930562206 2:52973811-52973833 GAGCATAGTGGCTTCTGGGAAGG - Intergenic
931061806 2:58537774-58537796 AAGCCTTTTGGCTTCTAGGAGGG - Intergenic
933164360 2:79059594-79059616 GAGGATAATGGATTCAAGGGAGG - Intergenic
941291182 2:163677536-163677558 GAGGCTAGTGGCTACTATGCTGG + Intronic
943631973 2:190263986-190264008 GAGGATAAAGGCTTCAAGTAGGG - Intronic
946068069 2:217007155-217007177 GAGGGTGATGGCTTGTTGGAGGG + Intergenic
946339527 2:219058850-219058872 GCTGCTATTGGCTCCTAGGAAGG - Intronic
946419646 2:219557653-219557675 GAGGCTCAGGGCTTTGAGGAGGG + Intronic
948339399 2:237237467-237237489 GAGGTTACTGGCTTGCAGGAAGG - Intergenic
1171199375 20:23228719-23228741 CAGGCTAAGTGCTTGTAGGAGGG - Intergenic
1173283937 20:41653922-41653944 GATGCTACTGTCTTCTTGGAGGG - Intergenic
1174888534 20:54363362-54363384 CAGGCTAATGGCGGGTAGGAGGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178521859 21:33293325-33293347 GAGGCAACTGCCTTCTGGGAAGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1181853300 22:25765380-25765402 GATTCTAATGGCTTCTTGCAAGG - Intronic
1185393181 22:50573501-50573523 GAAGGTATTGGCCTCTAGGAAGG - Exonic
950840516 3:15964098-15964120 GAGGCTAAAGGGCTCTAGGGGGG + Intergenic
952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG + Intronic
954870087 3:53761235-53761257 GAGCCTATTGGCTTCTTTGAAGG + Intronic
956526338 3:70166557-70166579 AAGGTCAGTGGCTTCTAGGAGGG - Intergenic
959063859 3:101638288-101638310 GAGCCAAATGGCTTCAAGCAGGG - Intergenic
966024063 3:175253679-175253701 GTGGCTAATGGCATTTAGAATGG - Intronic
967451390 3:189627489-189627511 GAGGCTACTGGCTACTATGTTGG - Intergenic
967481844 3:189981535-189981557 GTGGCTAATGGGTTGTAGGATGG - Intronic
967534315 3:190585303-190585325 GAGGCTAATGGCTTCTGATGTGG - Intronic
975320540 4:73005442-73005464 CAGACTAATGGTTTTTAGGAAGG + Intergenic
977340494 4:95751391-95751413 GTGGCTAATGGCTTATTGGTGGG - Intergenic
979123613 4:116936534-116936556 GTTGCTAATGGCATCTAGAATGG + Intergenic
979823612 4:125205046-125205068 GAAGCTGATGTCTACTAGGAGGG + Intergenic
979873644 4:125858820-125858842 GAGGCTCAGGGTTTCTGGGAGGG + Intergenic
981599441 4:146469102-146469124 GAGGCTAATGGCTTCTAGGAGGG + Intronic
984068952 4:175087148-175087170 GGGGCTAATGGCTTCAATGTAGG + Intergenic
984467555 4:180119753-180119775 GAGGTTAAATGCTGCTAGGAAGG - Intergenic
994870925 5:105350199-105350221 GAGGCTACTGGGCTCTAGGCTGG + Intergenic
995714983 5:115073337-115073359 GAGTCTGATTGCTTCTAGGCAGG + Intergenic
996864514 5:128104902-128104924 GAAGCTAAGGGCTTCTAACATGG - Intronic
997366818 5:133331031-133331053 GAGGCTCCTGGCCTCTAGGAAGG + Intronic
997378315 5:133415008-133415030 GATGCTAAGGGCTTCTAAGTTGG - Intronic
998384182 5:141747032-141747054 GAGGCCAATGGCTTCAGGAAGGG - Intergenic
999428358 5:151505941-151505963 GAGCCTAATGGCCTCTATGGGGG - Exonic
1000644382 5:163743110-163743132 GAGGCTAAGAGCTCCTAGGTTGG + Intergenic
1000883347 5:166721915-166721937 AAGCATAATGGCTTCTGGGAAGG + Intergenic
1002211539 5:177602266-177602288 AAGGCTACTGGCTTCCAGGTTGG + Intronic
1002384283 5:178854653-178854675 GAGCCTAATGCCTTCAGGGAAGG - Intergenic
1007620238 6:43208535-43208557 GTGGCTAATGGCTACTATGATGG + Intronic
1013097302 6:106957405-106957427 GAAGCTAGTGGGTTTTAGGATGG + Intergenic
1013796241 6:113892544-113892566 GAATCTAATGGCATCTAGAATGG - Intergenic
1014401856 6:120999606-120999628 GAGTCTAATGGCTGCCAGAAAGG + Intergenic
1015948202 6:138524379-138524401 GGGGCTAGTGGCTGCAAGGAGGG - Intronic
1016038911 6:139411667-139411689 GAAGCTAATGACTACTGGGATGG - Intergenic
1016978713 6:149834158-149834180 GAGAATAATGGCTTCTAGCCTGG + Intronic
1017073223 6:150594980-150595002 GATGCTACTGGTATCTAGGATGG + Intergenic
1021986147 7:26100304-26100326 CCGGCTAATGACTTCTAGGAGGG + Intergenic
1022477803 7:30723192-30723214 GATGGTCTTGGCTTCTAGGAGGG - Intronic
1023609714 7:41960378-41960400 GAGGATAATTGTTTCTGGGAAGG - Intergenic
1023865913 7:44238401-44238423 GAGGCTAGTGGCTTCTGGGGAGG - Intronic
1029974751 7:104822524-104822546 GGTGCTACTGGCTTCTAGTAGGG - Intronic
1032486338 7:132290248-132290270 GAGGCTTCTGGCTTCCAGGAAGG + Intronic
1033578123 7:142705777-142705799 GAATCTAATGGCTTCAAGGTAGG - Intergenic
1033586874 7:142780634-142780656 GAGGCGCATGGCTTGTTGGATGG - Intergenic
1034021978 7:147654693-147654715 GTTTTTAATGGCTTCTAGGATGG + Intronic
1037055601 8:14436607-14436629 GAATGTAATGGCTACTAGGACGG - Intronic
1038396483 8:27249472-27249494 GAGGCTATTGGCATTTTGGAAGG - Intronic
1041055536 8:53982180-53982202 GTTCCTAATGGCATCTAGGATGG - Intronic
1044700280 8:94959372-94959394 GAGGTCAATGGGTTCTTGGAAGG + Intronic
1049397311 8:142407121-142407143 GAGGCTCATGGATGCCAGGAGGG - Intergenic
1050188132 9:2996701-2996723 GAGCCTAAAGTCTTCTAAGAAGG - Intergenic
1052046730 9:23802581-23802603 TAGCCTAATGGATTCTTGGAAGG - Intronic
1052891597 9:33705578-33705600 GAATCTAATGGCTTCAAGGTAGG - Intergenic
1056445897 9:86666163-86666185 ATGGCCAATGGCTTCTAAGAGGG - Intergenic
1057440293 9:95078085-95078107 GAGGCTAACAGCATCCAGGAAGG - Intronic
1185725540 X:2418675-2418697 GAGCCTAGTGGCTTCAATGATGG - Intronic
1186552737 X:10523605-10523627 GAGGCTAATCCCTTGGAGGAAGG + Intronic
1187466747 X:19534324-19534346 GAAGCCAATGGCCTCTATGAGGG + Exonic
1187790482 X:22944887-22944909 GAGGCTAATGTGCTCTAAGATGG + Intergenic
1189047023 X:37604247-37604269 GAGGCCAATGACTTCAAAGATGG - Intronic
1189240176 X:39518829-39518851 GAGGGGAATGGATTCAAGGAAGG + Intergenic
1194928156 X:99852992-99853014 AAGGCTAATGGATTCCAAGAAGG - Intergenic
1197335696 X:125206632-125206654 GAGGGTAGTGGGTTTTAGGAAGG - Intergenic
1198711529 X:139509322-139509344 GAAGCCAATGGCCTATAGGAGGG - Intergenic
1198826509 X:140703708-140703730 GTTGATAATGGCTTCTAGAATGG + Intergenic