ID: 981599982

View in Genome Browser
Species Human (GRCh38)
Location 4:146476499-146476521
Sequence GTGTGCATGTGCATGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1839
Summary {0: 1, 1: 1, 2: 47, 3: 285, 4: 1505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981599979_981599982 7 Left 981599979 4:146476469-146476491 CCCGTTTAAATTGTGTGTGTGTT 0: 1
1: 0
2: 7
3: 83
4: 786
Right 981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG 0: 1
1: 1
2: 47
3: 285
4: 1505
981599980_981599982 6 Left 981599980 4:146476470-146476492 CCGTTTAAATTGTGTGTGTGTTG 0: 1
1: 0
2: 6
3: 56
4: 528
Right 981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG 0: 1
1: 1
2: 47
3: 285
4: 1505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981599982 Original CRISPR GTGTGCATGTGCATGTGTCT TGG Intronic
900009952 1:97049-97071 GCATGCATGTGCATGTGTGTTGG + Intergenic
900026064 1:273633-273655 GCATGCATGTGCATGTGTGTTGG + Intergenic
900035848 1:407488-407510 GCATGCATGTGCATGTGTGTTGG + Intergenic
900057469 1:643238-643260 GCATGCATGTGCATGTGTGTTGG + Intergenic
900078771 1:839304-839326 GTGTCCAGGTGTGTGTGTCTAGG - Intergenic
900078776 1:839346-839368 GTGTCCAGGTGTTTGTGTCTAGG - Intergenic
900078795 1:839514-839536 GTGTCCAGGTGTGTGTGTCTAGG - Intergenic
900078801 1:839584-839606 GTGTCCAGGTGTGTGTGTCTAGG - Intergenic
900122890 1:1056553-1056575 GGGTGCATGTACGTGTGTGTGGG + Intergenic
900150525 1:1177140-1177162 GTGTGTCTGTGCATGTTTATAGG + Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900187899 1:1341202-1341224 GTGTGCGTGTGCGTGTGTGCAGG - Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900416287 1:2536310-2536332 GTGTGCGTGTGTCTGTGTGTGGG - Intergenic
900489201 1:2938385-2938407 GTCTGTGTGTGCATGTGTGTGGG - Intergenic
900490254 1:2944632-2944654 GTGTGCATGTGTGTCTGTGTAGG + Intergenic
900566768 1:3336428-3336450 GTTTGCATGCACATGTGTGTTGG + Intronic
900754963 1:4427535-4427557 GTGTGCGTGTGTGTGTGTCTTGG + Intergenic
900764708 1:4496771-4496793 GTGTGCATGTGCAGGAGAATAGG - Intergenic
900953023 1:5869006-5869028 GTGTGCATGTGTGTGTGTATGGG - Intronic
901206456 1:7500120-7500142 GTGTGCGTGTGTATGTATATGGG + Intronic
901312067 1:8277044-8277066 GTGTGTATGTGTATATGTGTTGG - Intergenic
901474165 1:9477760-9477782 GTATGCATGTGTATGTGTGTGGG - Intergenic
901634040 1:10661416-10661438 ATGTGCATGTGACTGTGTGTGGG - Intronic
901634075 1:10662258-10662280 GTGAGCATGTGACTGTGTGTGGG - Intronic
901634083 1:10662321-10662343 GTGAGCATGTGACTGTGTGTGGG - Intronic
901634094 1:10662499-10662521 GTGTGCATGTGACCGTGTGTGGG - Intronic
901804604 1:11730259-11730281 GTGTGCATGTGTGTGGGTGTGGG - Intergenic
901804608 1:11730281-11730303 GTGTGCATGGGCATGTGCATGGG - Intergenic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804615 1:11730343-11730365 GTGTGCATGGGCATGTGCATGGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902244599 1:15112357-15112379 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
902463599 1:16599498-16599520 GTGTGTGTGTGTATGTGTGTGGG - Intronic
902511927 1:16971401-16971423 GTGTGTGTGTGCATGTGTGACGG - Intronic
902538368 1:17135051-17135073 GTGTGTATGTGCATGTGGGTGGG - Intergenic
902625779 1:17675477-17675499 GTGTGCAGGTGTGTGTGTATAGG + Intronic
902689848 1:18104093-18104115 GTGTGTGTGTGCCTGTGTGTGGG + Intergenic
902772848 1:18655793-18655815 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
902785335 1:18729478-18729500 GTGTGCATGTGTAAGTGTATTGG + Intronic
903424595 1:23244533-23244555 GCATGCATGTGCATTTGTGTGGG + Intergenic
903634744 1:24804368-24804390 GTATGTGTGTGCATGTGTGTGGG + Intronic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
903745920 1:25586588-25586610 GTGTGTGTGTGTATGTGTTTTGG + Intergenic
903892455 1:26578756-26578778 GTGTGAATATGAATGTGTTTAGG + Intergenic
904015753 1:27419179-27419201 GTGTGTATATGTATGTGTTTGGG - Intronic
904030174 1:27528590-27528612 GTGTGCGCGTCCATGTCTCTGGG + Intergenic
904036762 1:27563108-27563130 GCGTGCGTGTGTGTGTGTCTTGG - Intronic
904036766 1:27563177-27563199 GTGTGCATGTGTGTGTGTCTTGG - Intronic
904036768 1:27563226-27563248 GCGTGCGTGTGTGTGTGTCTTGG - Intronic
904036772 1:27563291-27563313 GTGTGCATGTGTGTGTGTCTTGG - Intronic
904036774 1:27563340-27563362 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
904209484 1:28877246-28877268 GTACGGATGTGCATGTGTATGGG - Intergenic
904813174 1:33177022-33177044 GTGTGCATGTGTATGTGTGTTGG - Intronic
904828195 1:33289217-33289239 GGCTGCATCTGCATGTGTGTTGG + Intronic
904839696 1:33364355-33364377 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
904973515 1:34437470-34437492 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
905174370 1:36126646-36126668 GTGTGTGTGTGCATGCGTGTAGG + Intergenic
905254857 1:36673867-36673889 GTGTGCATGTGCATGCAATTTGG + Intergenic
905267157 1:36762402-36762424 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
905303101 1:36999002-36999024 GTGTGTATGTGTGTGTGTGTTGG + Intronic
905347181 1:37319105-37319127 GTGTGCGTGTGTATGGGTCTGGG + Intergenic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
905672088 1:39798544-39798566 GTGTCCATGTGCATGGTTATTGG - Intergenic
906525760 1:46492274-46492296 TTGTGCATGTGAAAGTGGCTAGG - Intergenic
907035906 1:51216015-51216037 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
907281176 1:53348122-53348144 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
907552136 1:55313462-55313484 GTGTGCATGTGTGTTTGTGTAGG + Intergenic
907576396 1:55529744-55529766 GTATACATGTGTATGTGTGTGGG - Intergenic
907786864 1:57620991-57621013 GTGTGTGTGTGTTTGTGTCTGGG + Intronic
908031915 1:60009621-60009643 GTGTGCGTGTGTGTGTGTCCGGG - Intronic
908141128 1:61186211-61186233 GTCTGCCTGTGCTTGAGTCTTGG + Intronic
908433492 1:64081803-64081825 GTGTGTTTGTGTATGTGTGTGGG - Intronic
908512544 1:64860962-64860984 GTGTGTATGTGTGTGTGTGTTGG + Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909351021 1:74653373-74653395 GTGTGTGTGTGTCTGTGTCTGGG + Intronic
909753472 1:79193238-79193260 GTGTTTATGTTCTTGTGTCTGGG - Intergenic
910123436 1:83815384-83815406 GTTGGCATGTGCATGTGTGGAGG + Intergenic
910739869 1:90503408-90503430 GTGTGTGTGTGCGTGTGTATAGG - Intergenic
910839531 1:91547887-91547909 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
911061714 1:93753848-93753870 GTGTACGTGTACATGTGTGTTGG - Intronic
911139464 1:94483310-94483332 GTGTGTGTGTGTATGTGTGTCGG - Intronic
911772683 1:101766943-101766965 GTATGCATGTGTATGTATCTAGG - Intergenic
911902608 1:103525139-103525161 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
912040905 1:105389003-105389025 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912451794 1:109771940-109771962 GTCTGCGTGTGCATGCGTGTGGG + Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913076868 1:115347568-115347590 GTGTGCCTGTGTATGTGTGCTGG - Intergenic
913323823 1:117608891-117608913 GTGTGCATGTGTGTGTGTTTAGG + Intronic
913425038 1:118719187-118719209 GTGTGCGTGTGTGTGTGTGTGGG - Intergenic
913448361 1:118973763-118973785 GTGTGTGTGTGTATGTGTGTAGG - Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
913937403 1:125066879-125066901 GTGCGTGTCTGCATGTGTCTGGG + Intergenic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
914471357 1:147981314-147981336 GTGTGTATGTGTGTGTGTCGGGG - Intronic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915319405 1:155047957-155047979 GTGTGTGTGTGCAGGTGTGTAGG - Intronic
915328413 1:155093244-155093266 TTGTGTTTGTGTATGTGTCTGGG - Intergenic
915530154 1:156498640-156498662 GTGTGCATGTACATTTGTAAAGG - Intronic
915560705 1:156685753-156685775 ATGGGCATGTGCATGTGCCCAGG - Intergenic
915710287 1:157891103-157891125 GTGTGTATGTGTGTGTGTGTAGG - Intronic
915790951 1:158670567-158670589 GTATGTATGTGCATGTGGCAAGG + Intronic
915882788 1:159689716-159689738 GTGTGCATGCACGTGTGTGTGGG - Intergenic
915943544 1:160134276-160134298 GTGTGTATGTGTGTGTGTGTGGG - Intronic
916152663 1:161810562-161810584 ATGTGCAAGTGCATTTGTCTGGG + Intronic
916480362 1:165209035-165209057 GTGTGTATGTGTCTGTGTGTAGG + Intronic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917418728 1:174839326-174839348 GTGTGGATGTGCATGTGAGAGGG - Intronic
917486638 1:175460898-175460920 ATGAGCATGTACATGTGTGTGGG - Intronic
917677107 1:177330095-177330117 GTGTGTGTGTGCGTGTGTGTGGG - Intergenic
917757168 1:178113474-178113496 TTGTGTATGTGTATGTGTGTGGG + Intronic
917791755 1:178503637-178503659 GTGTGTATGTGCGTGTTTCTTGG - Intergenic
917999070 1:180473808-180473830 GTGTATATGTGCATATGTGTGGG - Intronic
918754573 1:188322441-188322463 GTGTGTGTGTGCTTGTGTGTGGG + Intergenic
918770810 1:188557407-188557429 GTGTGTGTGTGCATGTGAGTTGG + Intergenic
918902342 1:190439533-190439555 GTGTGTGTGTGTATGTGTATGGG + Intronic
919433611 1:197529390-197529412 GTGTGCATATGCGTGTGCCAGGG + Intronic
919502196 1:198350886-198350908 GTGTGCACATGCGTGTGTTTTGG - Intergenic
919728617 1:200899379-200899401 GTGTGCATGTGCATTCCCCTAGG + Intronic
919861928 1:201745251-201745273 GTGTACATATGCATGTGTGTGGG - Intronic
919976032 1:202613411-202613433 GTGTGCATGTGTGTGTGTGCTGG + Intronic
920302085 1:204995342-204995364 GTGTGTGTGTGTATGTGTGTCGG + Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920498619 1:206472560-206472582 GTGTGTGTGTGTATGTGTGTAGG - Intronic
920543995 1:206800590-206800612 ATGTGAGTGTGCATGTGTTTAGG + Intronic
920599492 1:207309071-207309093 GTATGCATATGCATGTGTACAGG - Intergenic
920868236 1:209770942-209770964 GTGTGCGTGTGCATGTGGAGGGG + Intronic
921010522 1:211136001-211136023 GTGTGTATGTGTGTGTGTATTGG + Intergenic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921549477 1:216516620-216516642 GTGTGTATGTGTGTGTGTTTAGG - Intronic
921931607 1:220758833-220758855 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
922258383 1:223913056-223913078 GCATGCATGTGCATGTGTGTTGG + Intergenic
922399003 1:225232376-225232398 ATGTGCTTGTACATGTCTCTTGG + Intronic
922746386 1:228046558-228046580 GTGTGCATGTGCATGGGGTGGGG + Intronic
923287796 1:232513821-232513843 ATGGGCGTTTGCATGTGTCTCGG - Intronic
923380247 1:233410627-233410649 GTGTGCATGTGCATATATGCTGG - Intergenic
923822824 1:237465073-237465095 GTGTGCATGTGTGTGTATGTAGG - Intronic
924025116 1:239824012-239824034 GTGTGCCTGTGGCTGTGACTCGG + Intronic
924218009 1:241845385-241845407 GTGTGCATGTGTGTGTGTGGTGG + Intergenic
924339583 1:243015819-243015841 GCATGCATGTGCATGTGTATTGG + Intergenic
924861223 1:247924687-247924709 GTGTGCATGTGTATATGTGTGGG - Intergenic
1062800309 10:374106-374128 GTGTGGGTGTGCATCTGTGTAGG + Intronic
1062993398 10:1842082-1842104 GTCTGTATGTGCATGTGTGGGGG - Intergenic
1063054567 10:2490400-2490422 GTATGCATGTGCGTGTGTGTGGG - Intergenic
1063168283 10:3483771-3483793 GTATACATGTGCATGTGGTTTGG + Intergenic
1063247825 10:4241372-4241394 GTGTGCATGTGTGTGTTTGTAGG - Intergenic
1063506252 10:6602558-6602580 GTGCATATGTGCATGAGTCTGGG - Intergenic
1063539067 10:6913824-6913846 GTGTGCATGTGTCTGTGTATTGG - Intergenic
1063588990 10:7378067-7378089 GTGTGCATGTGTATGTGGATGGG + Intronic
1063624142 10:7673671-7673693 GTGTGCATGCGCATGAGCCCAGG - Intergenic
1063672785 10:8112844-8112866 GTCTGTATGTGTATGTGACTTGG - Intergenic
1063853844 10:10224343-10224365 GTGTGTGTGTGTACGTGTCTAGG + Intergenic
1063946299 10:11179699-11179721 GTGTGCGTGTGCCTGTGTTGGGG + Intronic
1064097917 10:12437575-12437597 GAGAGCCTGTGCATGTGTGTAGG - Intronic
1064120683 10:12615718-12615740 GTGTGAGTGTGCATGTGTGTGGG + Intronic
1064630912 10:17309653-17309675 GTGTGGGTGTGAATGTGTCCTGG + Intergenic
1065122231 10:22541516-22541538 GTGTGTATGTGCATATGTACAGG + Intronic
1065317402 10:24476791-24476813 GTGTCTATGTGCAGGTCTCTAGG - Intronic
1065897475 10:30176788-30176810 CTTTGCATGTGGATGTGTCAGGG - Intergenic
1065957008 10:30702803-30702825 GTGAGCATTTGCAGGTGACTGGG + Intergenic
1065997592 10:31073699-31073721 GTGTGCGTGCGCATGTGTGTAGG + Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1066467840 10:35669085-35669107 GCGTGTGTGTGCATGTGTGTAGG + Intergenic
1066482899 10:35814084-35814106 GTGTGTATGTGCATGTGTTCGGG - Intergenic
1067438148 10:46293123-46293145 GTGTGCAGGTGCCTGAGTGTGGG + Intronic
1067438153 10:46293178-46293200 ATGTTCAGGTGCATGTGTGTGGG + Intronic
1067438173 10:46293464-46293486 GTGTGTGTATGCATGTGTGTGGG + Intronic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1067897397 10:50198967-50198989 GTCTGTATGTGTCTGTGTCTGGG - Intronic
1067951574 10:50743062-50743084 GTCTGTATGTGTCTGTGTCTGGG + Intronic
1068183407 10:53552070-53552092 GTGTGTATGTGTATGTGTACAGG - Intergenic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068704113 10:60054103-60054125 GTGTACATGTGCATATGTATGGG - Intronic
1069289707 10:66763039-66763061 GAGTGTATGTGCATGTCTGTGGG + Intronic
1069558665 10:69414389-69414411 GTGTACACGTGCAAGTGTGTGGG - Intronic
1069746864 10:70720696-70720718 GCACGCATGTGCATGTGTGTGGG - Intronic
1070191334 10:74114433-74114455 GTGTGCGTGTGTGTGTGTGTTGG + Intronic
1070313917 10:75293663-75293685 GTGCGCATGTGTGTGTGTGTAGG + Intergenic
1070505018 10:77105139-77105161 GTGCACATGTGCGTGTGTGTTGG - Intronic
1070522702 10:77268307-77268329 GTGTGTGTGTGCCTGTGTGTAGG - Intronic
1070547238 10:77462562-77462584 GTGTGTAAGTGCATGTGTGAGGG - Intronic
1070760350 10:79020420-79020442 GCGTGCAAGTGTGTGTGTCTGGG - Intergenic
1070761307 10:79026146-79026168 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1070802870 10:79253859-79253881 GTGTGCATGTACCTGTGTGTGGG - Intronic
1070909294 10:80103458-80103480 GTGTGCATGTGTGTGTGTGGTGG + Intergenic
1070911950 10:80126758-80126780 GTGTGAATGTGGATGTCTCTCGG - Intergenic
1071067624 10:81655686-81655708 TTGTGCATGTCCATTTCTCTGGG + Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071319001 10:84433424-84433446 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071338085 10:84618153-84618175 GCATGCATGTGGATGTGTTTTGG + Intergenic
1071338316 10:84620386-84620408 GCATGCATGTGGATGTGTTTTGG - Intergenic
1071346685 10:84700248-84700270 GTGTGCATGTGAGCGTGCCTGGG + Intergenic
1071496469 10:86170666-86170688 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1071876614 10:89850018-89850040 GTGTGTATGTGTGTGTGTCTAGG + Intergenic
1072061673 10:91818536-91818558 GTGTGCATGTGTGTGTATCAAGG + Intronic
1072070340 10:91909099-91909121 GTTCGCAGGTGCATGTGTCTGGG - Intronic
1072502800 10:96035264-96035286 ATGTGCATGTGTGTGTGTGTTGG - Intergenic
1072627504 10:97122582-97122604 AAGTGCATGTGCATCTGTCCAGG + Intronic
1072774022 10:98171052-98171074 GTGTGCATGCCTATGTGTTTTGG - Intronic
1072870366 10:99112940-99112962 GTGTGTGTGTGTATGAGTCTAGG - Intronic
1072945464 10:99806095-99806117 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1073007237 10:100333986-100334008 GAGTGCAGGTGCATGTGTGTGGG + Intergenic
1073007244 10:100334026-100334048 ATGTGCAGATGCATGTGTGTGGG + Intergenic
1073036983 10:100570812-100570834 GTGATGATGTGGATGTGTCTGGG + Intergenic
1073070281 10:100788873-100788895 GTGTGCATGTATGTGTGTCGGGG - Intronic
1073139011 10:101235731-101235753 GTGAGCATGTGTGTGTGTGTTGG + Intergenic
1073217063 10:101842307-101842329 CTGTGCATGTGCATGTTCCTGGG - Intronic
1073250471 10:102117881-102117903 TTCTGCGTGTGCATGTGTGTGGG + Intronic
1073511888 10:104047636-104047658 GTGTGCATGTGCAGGTGTGCAGG - Intronic
1073677000 10:105659295-105659317 GTGTGTGTGTGCATGGGTTTGGG + Intergenic
1073771142 10:106737065-106737087 GTGTGTATGTGTAGGTGTCAGGG + Intronic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074024420 10:109619598-109619620 GTATGCATATGCATCTGTGTGGG + Intergenic
1074224599 10:111472146-111472168 GAGTGCATGTGGCTGTGGCTGGG - Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074345358 10:112679950-112679972 GTGTGTATATGCATCTTTCTGGG + Intronic
1074372741 10:112913411-112913433 GTGTGGATGTGGGTGTGTGTGGG + Intergenic
1074372745 10:112913441-112913463 GTGTGAATGTGGGTGTGTGTGGG + Intergenic
1074372749 10:112913483-112913505 GTGTGGATGTGGGTGTGTGTAGG + Intergenic
1074454610 10:113586456-113586478 GTGTGCGTGTGTGTGTGTGTGGG + Intronic
1074707499 10:116148108-116148130 GGGTGTGTGTGCATGTGTGTGGG + Intronic
1074755943 10:116624287-116624309 GTGTGAATGTGTAAGTTTCTGGG - Intronic
1074833752 10:117269138-117269160 GTGTGCATATGTATGTGGGTGGG - Intronic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074869173 10:117563704-117563726 GTGTGTGTATGGATGTGTCTGGG + Intergenic
1074887578 10:117706023-117706045 GTGTGTATGTGTGTGTGTTTTGG + Intergenic
1075137911 10:119802456-119802478 TTGTGTATATGCATGTGTCAAGG - Intronic
1075241521 10:120783349-120783371 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1075311053 10:121413780-121413802 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
1075450788 10:122550767-122550789 GTGTGCAAGTGCTTGAGTGTGGG - Intergenic
1075627080 10:123971126-123971148 GTGTGTATGTGTTTGTGTGTGGG - Intergenic
1075654892 10:124154734-124154756 GGGTGAGTGTGCATGTGTGTGGG - Intergenic
1075654908 10:124154862-124154884 GGGTGAGTGTGCATGTGTGTGGG - Intergenic
1075665090 10:124224203-124224225 GTGTGCATGTGTATGTTGGTGGG - Intergenic
1075710832 10:124529774-124529796 ATGTGCATGAGCTGGTGTCTAGG - Intronic
1075813374 10:125245195-125245217 GTGTGCCTGTGCATTTTTCTGGG + Intergenic
1075816197 10:125266459-125266481 GTGTGCATGTGTGTGTGTATAGG + Intergenic
1075859106 10:125659350-125659372 GTGTACATCTGCATGTGAATTGG + Intronic
1075871661 10:125775607-125775629 GTGTGCACGTGCACGGGCCTGGG + Intronic
1075913143 10:126143521-126143543 GTGTATATGTACATGTGTATGGG + Intronic
1076139335 10:128067205-128067227 GTGTGCATGTGAATGTGTGTGGG - Intronic
1076253207 10:128999250-128999272 GTGTGTGTGCGCATGTGTTTAGG - Intergenic
1076474295 10:130741825-130741847 GGGTGCATGTGCATGTTTTCTGG - Intergenic
1076535843 10:131176455-131176477 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076535852 10:131176679-131176701 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535862 10:131176877-131176899 GTCTGTGTGTGCATGTGTTTTGG - Intronic
1076535863 10:131176911-131176933 GTGTCTGTGTGCATGTATCTTGG - Intronic
1076610688 10:131724028-131724050 GTGTGTGTGTGCGTGTGTGTGGG - Intergenic
1076749410 10:132535185-132535207 GTGTGCATGTGTTTCTGTGTGGG + Intergenic
1076787008 10:132754931-132754953 GCGTGCATATGCATGTGAATGGG + Intronic
1077142944 11:1032722-1032744 GGGTGTGTGTGCATGTGTGTTGG + Intronic
1077169080 11:1158441-1158463 GTGTGCAAGGGCAGGTGCCTGGG - Intronic
1077172810 11:1175751-1175773 GTGAGCGTGTGCATGAGTGTGGG - Intronic
1077223783 11:1429065-1429087 GTGTGCATGGGTGTGTGTCCTGG + Intronic
1077418007 11:2434337-2434359 GTGTGTGTGTGAATGTGTGTAGG + Intergenic
1077547667 11:3182570-3182592 GTCTGCATGCACTTGTGTCTGGG - Intergenic
1077548274 11:3186432-3186454 GTCTGCATGCACTTGTGTCTGGG - Intergenic
1077945875 11:6897741-6897763 GTGTGTATGTCCGTGTGTATTGG - Intergenic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078086566 11:8236857-8236879 GTGTGTATGAGCATGCGTTTTGG + Intronic
1078408506 11:11092361-11092383 GTGTGTATGTGTATGTGGCTAGG - Intergenic
1078424800 11:11240408-11240430 GTGTACATGTGCATGTTTGTAGG - Intergenic
1078823643 11:14906497-14906519 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1078874727 11:15381496-15381518 GTGTTTGTGTGCATGTGTGTTGG + Intergenic
1078930325 11:15907444-15907466 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
1079015819 11:16867816-16867838 GTGTACACGTGCATGTGTGTAGG - Intronic
1079028302 11:16966310-16966332 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1079133663 11:17763862-17763884 GTGTACATGTGCATGTGTGGTGG - Intronic
1079309577 11:19352906-19352928 GTGTGCATGTGTGTGTTTGTGGG + Intronic
1079383113 11:19956355-19956377 GTGTGTGTGTGTATGTGTGTCGG - Intronic
1079405226 11:20139192-20139214 GTGTGCAGGTGTCTGTGTTTGGG - Intergenic
1079449086 11:20583836-20583858 GTGTTCCTATGCATGTGTATTGG - Intergenic
1079465997 11:20731553-20731575 GTCTGCATGGGCATGAGTGTGGG + Intronic
1079691133 11:23418432-23418454 GTGTGCATGTGAATGTGTCCTGG - Intergenic
1079903467 11:26217391-26217413 GTGTAAATGTCCGTGTGTCTTGG + Intergenic
1080776319 11:35390277-35390299 GTGTGCACGTGCCTGTGTGTGGG - Intronic
1081044107 11:38250544-38250566 GTGTGAATCTGGCTGTGTCTGGG + Intergenic
1081322366 11:41706758-41706780 GTGTGCATGTGTGTGTGTTTAGG + Intergenic
1081408482 11:42726314-42726336 GTGTGTATGTGTATGTGTGCTGG - Intergenic
1081650354 11:44819433-44819455 GTGCGCATGTGCATGTGTGTCGG + Intronic
1081665208 11:44912638-44912660 GTGTGCATACTCATGTGTATGGG + Intronic
1081691887 11:45083938-45083960 GTGTACAACTGTATGTGTCTGGG - Intergenic
1081831542 11:46120106-46120128 GTGTGTTGGTGCATTTGTCTTGG - Intronic
1081994744 11:47356123-47356145 GTGTGAATGTGCAAGTGGGTGGG - Intronic
1081994777 11:47356388-47356410 GTGTGAGTGTGCATGTGAGTGGG - Intronic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1083301523 11:61742037-61742059 TTGTACATGTGCATGTCTGTAGG - Intronic
1083557438 11:63642071-63642093 GTGTGTATGTGTATGTCTCTAGG - Intronic
1083743800 11:64724117-64724139 CTGTGCATGTGTATGAGTGTGGG + Intergenic
1083766538 11:64844165-64844187 GTATGTGTGTGCATGTGTCGGGG + Intronic
1083897075 11:65625333-65625355 CTGTGCATGTGCCCGTGACTGGG + Intronic
1083960974 11:66014877-66014899 GTGTGCGTGTGTATATGTATGGG - Intergenic
1084009940 11:66341963-66341985 CTGTGTATGTGCTTGTGTGTAGG + Intronic
1084009946 11:66342031-66342053 GTGTGCATGTGTGTGTGTAGGGG + Intronic
1084360080 11:68663549-68663571 GTGTGCATGTGCGTCTGCCTGGG - Intergenic
1084386840 11:68848555-68848577 GTGTGCATGTGTGTGTTTCCAGG - Intergenic
1084523481 11:69680907-69680929 GTCTGTGTGTGCATGTGTGTGGG - Intergenic
1084609169 11:70190971-70190993 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609171 11:70191015-70191037 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609173 11:70191099-70191121 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609176 11:70191223-70191245 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1084952286 11:72673474-72673496 GGGTGCATGTGCAAGTGAGTGGG - Intronic
1085153379 11:74270046-74270068 GTGTGTATGTGTGTGTGTCTTGG - Intronic
1085379773 11:76104677-76104699 GTGTGCATGTATATGTGTGGTGG - Intronic
1085434643 11:76489261-76489283 CTGTGCATGTCCATGTTACTTGG + Intronic
1085582405 11:77665753-77665775 GTGTGCGTGTGTGTGTGTGTTGG - Exonic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1085976745 11:81664433-81664455 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
1086158987 11:83699926-83699948 GTGTGTGTGTGCATGTGTGGTGG - Intronic
1086401315 11:86463158-86463180 GTGTTCCTGTGCCTGTGTTTAGG + Intronic
1087135811 11:94718152-94718174 GTGTACATGTGTATCTTTCTTGG + Intronic
1087218136 11:95516986-95517008 GTGTTTATGTGCATGTGTAAGGG - Intergenic
1087478564 11:98669570-98669592 GTGTGCATGTGTGTGTGTGTTGG - Intergenic
1087943324 11:104127709-104127731 GTGTGCATGTGTGTGTGTGAAGG + Intronic
1088010887 11:104999593-104999615 GTGTGTGTTTGCATGTGTGTGGG - Intronic
1088231377 11:107676788-107676810 GTATGCATGTGTGTGTGTTTGGG - Intergenic
1088324905 11:108592075-108592097 CGGTGCATGTGCATATGTGTAGG + Intronic
1088735090 11:112722171-112722193 GTGTGCATTTGTGTGTGTGTGGG + Intergenic
1088751650 11:112847164-112847186 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1088846547 11:113673116-113673138 GTGTGTATGTGTGTGTGTATTGG - Intergenic
1088996167 11:114999235-114999257 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1089070586 11:115696607-115696629 GTGTGCGTGTGAGTGTGTGTGGG - Intergenic
1089188251 11:116635620-116635642 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1089210408 11:116796779-116796801 ATGTGTATTTTCATGTGTCTTGG - Intergenic
1089325588 11:117654756-117654778 GGGTGGGTGTGCATGTGCCTGGG - Intronic
1090096811 11:123750376-123750398 GTGTGCATTTGTGTGTGTGTGGG - Intergenic
1090242790 11:125195866-125195888 GTGTGCATGTACATATTCCTTGG - Intronic
1090298365 11:125610747-125610769 GTGTGTATGTGTGTGTGTGTGGG - Intronic
1090440828 11:126724362-126724384 GTCTGCATGTGCATGTGTGTGGG - Intronic
1090816236 11:130298828-130298850 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1090826402 11:130389837-130389859 ATGTGCATGCACATGTGTATAGG + Intergenic
1090834062 11:130441027-130441049 TTTTGCGTGTGCATGTGCCTGGG + Intergenic
1090873921 11:130772059-130772081 GTGTGCATGTGCACGTGTGTGGG + Intergenic
1090916289 11:131165954-131165976 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1090950913 11:131472495-131472517 GTGTGAGTGTGTATGTGTGTTGG + Intronic
1091040840 11:132279737-132279759 GTGGGTATGGGCATGTGTGTGGG - Intronic
1091114735 11:133002694-133002716 GTGTGGGTGTGAATGTGTATAGG + Intronic
1091150757 11:133326411-133326433 GTGTGGATATGCATGTGTGTGGG + Intronic
1091196830 11:133738721-133738743 GTGTGTATGTGGGTGTGTGTGGG + Intergenic
1091196891 11:133739001-133739023 GTGTGTATGTGGGTGTGTGTGGG + Intergenic
1091196978 11:133739375-133739397 GTGTGTTTGTGTATGTGTGTGGG + Intergenic
1091215972 11:133902339-133902361 GTGTGGTTGTGTATGTGTGTGGG - Intergenic
1091228814 11:133974613-133974635 GTGTGCATGTGTGTGTGTTCAGG - Intergenic
1091600503 12:1915131-1915153 GTATGCATATGCATGTGTGTGGG - Intronic
1091775439 12:3181975-3181997 GTGTGCTTGTGTTTGTGTGTTGG + Intronic
1091879675 12:3967051-3967073 GTGTGCACGTACCTGTGTATGGG + Intergenic
1091926860 12:4358355-4358377 ATGTGTATGTGCGTGTGTTTTGG + Intergenic
1092106187 12:5923127-5923149 GTGTGCATGTGTGTGTATGTGGG - Intronic
1092119306 12:6032995-6033017 GTATGCATGTGCGTGTGTGTGGG - Intronic
1092630752 12:10373706-10373728 GTGTGTGTGTGCATATGTTTAGG + Intronic
1093273474 12:17095363-17095385 GTGTGCATGTGGATGTGTATTGG + Intergenic
1093297887 12:17414123-17414145 GTGTGTATGTGTGTGTGTTTGGG - Intergenic
1093410412 12:18858421-18858443 GTGTGCATGTGTGTGTATGTTGG - Intergenic
1093432067 12:19095454-19095476 GTGGGAATGTGTATTTGTCTTGG - Intergenic
1093545653 12:20343290-20343312 CTGTGTATGTGCATATGTGTTGG - Intergenic
1094019962 12:25903721-25903743 GTTTGCATGTGTGTGTGTTTTGG - Intergenic
1094212706 12:27909470-27909492 GTGTGCATGTGCATGCATGTTGG + Intergenic
1094697496 12:32834997-32835019 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1095038796 12:37421089-37421111 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1095731925 12:45515286-45515308 GTGTGTGTGTGCATGTCTATGGG - Intergenic
1095739471 12:45591459-45591481 GTGTACATGTGCATTTTTCTAGG + Intergenic
1096124901 12:49111975-49111997 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1096154464 12:49334310-49334332 GTGTGCCTGTGCGTGTGCATAGG + Intronic
1096418380 12:51433518-51433540 GTGTGAATGTGCACTTTTCTTGG - Intronic
1096773047 12:53948677-53948699 GTGTGTGTGAGCATGTGTTTCGG + Intergenic
1096901722 12:54889891-54889913 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
1097445386 12:59665840-59665862 GTGTCTATGTGTGTGTGTCTTGG + Intronic
1097823386 12:64150134-64150156 GTGTGCATGTGCACGTGTGTGGG + Exonic
1098125226 12:67284778-67284800 GTGTGTATGTGTGTGTGTCGGGG - Intronic
1098484296 12:71003051-71003073 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1099139382 12:78952435-78952457 GACTGCATGTGCCTCTGTCTTGG + Intronic
1100164359 12:91899979-91900001 GTGTGCGTGTGCCTGTGGATGGG - Intergenic
1100813150 12:98360330-98360352 CTGTGCATGTGTGTGTGTGTGGG + Intergenic
1101114526 12:101518961-101518983 ATGTGCATGTGTGTGTGTATAGG - Intergenic
1101307096 12:103539287-103539309 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
1101609952 12:106282156-106282178 GTGTGTGTGTGTATTTGTCTTGG - Intronic
1101944571 12:109126779-109126801 TTGTGGATGTGCATCTTTCTGGG + Intronic
1102041816 12:109805809-109805831 GTGTGTCTGTGCATGAGTGTGGG - Intronic
1102268940 12:111513610-111513632 GTGTGCATGTGTGTGTGAATGGG - Intronic
1102328673 12:112011322-112011344 GTGTATGTGTGAATGTGTCTGGG - Intronic
1102465461 12:113128241-113128263 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1102723049 12:115034443-115034465 TTGGGCAGGAGCATGTGTCTGGG - Intergenic
1102766428 12:115437414-115437436 GAGTGTGTGTGCATGTGTGTTGG - Intergenic
1102835289 12:116052068-116052090 GTGTGTGTGTGTATGTGTGTAGG - Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103057972 12:117836478-117836500 GTGTGCTTTTGCCTCTGTCTGGG - Intronic
1103320375 12:120089284-120089306 GTGTGTATGTGTGTGTGTGTGGG + Intronic
1103409774 12:120702630-120702652 GTGTGTGTGTGTCTGTGTCTGGG - Intergenic
1103907217 12:124333924-124333946 GTGTGCGCGCGCATGTGTGTGGG + Intronic
1103907223 12:124333994-124334016 GTGTGTGTGCGCATGTGTGTGGG + Intronic
1103950133 12:124545931-124545953 GTGTGGCTTTGCATGTGTCCTGG - Intronic
1104080256 12:125423961-125423983 GTGTGTATTTGCATTTTTCTGGG - Intronic
1104168431 12:126256576-126256598 GTATGAATGTGCATGTGTATTGG + Intergenic
1104308442 12:127632060-127632082 GTGTGTATGTGTGTATGTCTTGG + Intergenic
1104372173 12:128233129-128233151 GTGTGCATGCATATGTTTCTGGG - Intergenic
1104424637 12:128665610-128665632 GTGTGTGTGTGCCTGTGTTTGGG - Intronic
1104470267 12:129024644-129024666 GTGAGCATGTGGATGTGTGTGGG - Intergenic
1104513150 12:129399875-129399897 GTGTGCGTGTGTGTGTGTGTGGG + Intronic
1104578482 12:129990585-129990607 GCGTGCGTGTGCATGTGTTTAGG - Intergenic
1104752252 12:131247226-131247248 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1104905932 12:132213457-132213479 GTGTGAGTGTGCCTGTGTGTGGG - Intronic
1104917967 12:132275868-132275890 GTGTGCATGTGTGTGTGCCCAGG + Intronic
1104919693 12:132284250-132284272 GTGTGCACCTGCATGTGTGCGGG - Intronic
1104944948 12:132411438-132411460 GTGTGCATGTGTGTGTGTGTGGG - Intergenic
1104944956 12:132411487-132411509 GTGTGCACGTGTGTGTGTGTGGG - Intergenic
1104971198 12:132531409-132531431 GTGTGCATGTGCGTGTGGGCAGG + Intronic
1105006953 12:132727521-132727543 GGGCGCATGTGCCTGAGTCTGGG - Intronic
1105405622 13:20129807-20129829 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1105474600 13:20719388-20719410 GTGAGCATGGGCAGGTGTGTGGG - Intronic
1105532048 13:21229250-21229272 GTGTGAATGTGCATGTGGGGTGG - Intergenic
1105962557 13:25355307-25355329 GTGTGCATGTGTGTGTGTGGGGG - Intergenic
1106421276 13:29588382-29588404 GTGTGCATGTGAGTTTGTGTGGG + Intronic
1106643699 13:31610911-31610933 GTGTGCATTAGCATGTGTGGTGG + Intergenic
1106835847 13:33634704-33634726 GTGTGCATGTGTGTGTGTGGCGG - Intergenic
1106900532 13:34350690-34350712 GCGTGCATGTGTCTGTGTGTTGG - Intergenic
1107022053 13:35762038-35762060 GTGTAGGTGTGCATGTGTGTAGG - Intergenic
1107022067 13:35762264-35762286 GTGTGTATGTGTAGGTGTGTAGG - Intergenic
1107022185 13:35763748-35763770 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
1107308047 13:39044251-39044273 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1107637789 13:42410298-42410320 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1107825647 13:44326783-44326805 ATGTGCATGCGCATGTCTTTGGG + Intergenic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108375953 13:49814493-49814515 GTGTTCATGTGCAATTTTCTGGG - Intergenic
1108383333 13:49875107-49875129 GTGTGTATGTGTGTGTGTCCAGG + Intergenic
1108592177 13:51921918-51921940 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1108777228 13:53781543-53781565 GTGTGCGTGTGTGTGTGTGTTGG + Intergenic
1108868040 13:54945426-54945448 GTGTGTATGTGCATATGTAAGGG + Intergenic
1108888787 13:55226790-55226812 GTGTGCATCTACATGTGTGCTGG - Intergenic
1108959893 13:56213601-56213623 GTGTGTTTGTGTATGTGTGTGGG - Intergenic
1109195543 13:59374403-59374425 GTGTGTATGTGCACGTGTATGGG - Intergenic
1109209629 13:59519945-59519967 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
1109442260 13:62390936-62390958 GTGTGCATGTGTGTGTGTCTTGG + Intergenic
1109622016 13:64923070-64923092 GTGTGCGTGTGTGTGTGTATAGG + Intergenic
1109936175 13:69287689-69287711 GTGTGCACGTGTGTGTGTGTTGG + Intergenic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1110695492 13:78483619-78483641 GAGTATATGTGCATGTGTGTGGG + Intergenic
1110720679 13:78758071-78758093 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1110820850 13:79914396-79914418 ATGTGTATGTGGGTGTGTCTTGG + Intergenic
1111006023 13:82250110-82250132 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1111173823 13:84565913-84565935 GTGTTCATGTGGATGTGGCTAGG - Intergenic
1111331830 13:86768326-86768348 GTGTGCATATGTATGTGCATTGG + Intergenic
1111358587 13:87144589-87144611 GTGTGTCTGTGTGTGTGTCTGGG - Intergenic
1111617372 13:90677704-90677726 GTGTGCATGTGTGTGTGTATGGG + Intergenic
1111644280 13:91010555-91010577 GTGTGTAAGTGCACGTGTATAGG - Intergenic
1111816168 13:93156160-93156182 GTGTGCATATCTATGTGTCTGGG - Intergenic
1112439337 13:99414509-99414531 GTGTGAGTGTGCATGTGTTTGGG - Intergenic
1112676491 13:101708012-101708034 GTGTGTGTTTGCATGTGTGTAGG - Intronic
1112933163 13:104766494-104766516 GTGTGCCTGTGTGTGTGTGTGGG - Intergenic
1113225657 13:108156936-108156958 GTGTGTATGTGTGTGTGTGTGGG - Intergenic
1113327448 13:109295507-109295529 GTGTGAATGTGTTTGTGTGTAGG - Intergenic
1113459936 13:110474881-110474903 GTGTGCATAGGCACGTGTGTGGG - Intronic
1113544080 13:111133305-111133327 ATGTGCATATCCATGTGTATAGG - Intronic
1113613808 13:111666491-111666513 GTGTGCATGTGCATGTGTGCAGG + Intronic
1113742512 13:112721421-112721443 GTGTGCATTTGGATATGTCGAGG + Intronic
1113791624 13:113031995-113032017 GTGTACATGTGCAGGTCTGTGGG - Intronic
1113892505 13:113743857-113743879 GTGAGCGTGTGCATATGTGTGGG + Intergenic
1113913862 13:113859750-113859772 GTGTGCATGTGTCTGTGTGTGGG + Intronic
1113962779 13:114134264-114134286 GTATGTCTGTGCATGTGTATGGG - Intergenic
1114589733 14:23850485-23850507 GTGTGTATGTATATATGTCTAGG + Intergenic
1114669946 14:24405074-24405096 GTGTGTGTGTGTATGTGTGTTGG + Intronic
1114904951 14:27115664-27115686 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1114992613 14:28306335-28306357 GTGTGTGTGTGCATGTGTGAAGG + Intergenic
1115322876 14:32104041-32104063 TTGTGCATGTGCATTTTTCTAGG - Intronic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1115844914 14:37518810-37518832 GTGAGCATTTGCTTGTTTCTTGG - Intronic
1115914010 14:38289392-38289414 GTGTGTATGTGTGTGTGTCCAGG - Intergenic
1116258827 14:42595055-42595077 GTGTGTGTGTGCGTGTGTGTGGG + Intergenic
1116296157 14:43113071-43113093 GTGTGTATGTGTGTGTGTCTAGG - Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1116815844 14:49582921-49582943 GTGTGCATGTGCGTATTTGTGGG - Intronic
1117524505 14:56584016-56584038 GTGTGTGTGTGTATGTGTTTAGG + Intronic
1117932913 14:60864794-60864816 GTGTGTATGTGCATTTGGTTTGG + Intronic
1117959445 14:61148483-61148505 GTGTGTGTGTGCACGTGTGTGGG + Intergenic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118133031 14:62989016-62989038 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1118188568 14:63559708-63559730 GTGTGTTTGTGTATGTGTATGGG + Intergenic
1118323336 14:64765887-64765909 GTGTGCATGTGTGTGTGTGTGGG + Intronic
1118323389 14:64766286-64766308 GTGGGCATGTGCCTGTGTGTAGG + Intronic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118798724 14:69169042-69169064 AAGTGCATCTGCATGTGTGTTGG + Intergenic
1118954437 14:70467146-70467168 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1119431394 14:74570290-74570312 TTGTGCATGGGCATGTGTGGGGG - Intronic
1119488357 14:75007836-75007858 GTTTGTGTGTGCATGTGTTTTGG + Intronic
1119717085 14:76867036-76867058 GTGTGCATGTGGTAGTGTGTGGG + Intronic
1120150084 14:81023015-81023037 GTGTGCATGTGGAGATCTCTTGG + Intronic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1120475277 14:84978909-84978931 GTGTGCATGTGTATATCTGTTGG - Intergenic
1120486851 14:85124904-85124926 GTGTGTGTGTGAATGTGTGTGGG - Intergenic
1120673892 14:87396253-87396275 GGGTGGATGTGCATGCGTGTTGG + Intergenic
1120784426 14:88518974-88518996 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1120842580 14:89098692-89098714 GTGTGCATGCACATATTTCTTGG + Intergenic
1121185415 14:91963265-91963287 GAGTACATGTGCATGTGGCATGG + Intergenic
1121301620 14:92876145-92876167 GTATGTGTGTGCATGTGTGTGGG - Intergenic
1121656585 14:95601515-95601537 GTGTGCATGTGTGTGTGGGTCGG + Intergenic
1121702238 14:95963270-95963292 GTGTGTATGTGCCTGTGTGTGGG - Intergenic
1122137676 14:99644444-99644466 GTGTGCGTCTGTATGTGTGTGGG + Intergenic
1122324345 14:100873703-100873725 GTGTCCCTGTGCATGTGTGTTGG + Intergenic
1122807481 14:104267332-104267354 TTGTGCATGTGTATGCGTGTGGG - Intergenic
1122811126 14:104289129-104289151 GTGTGCATATGTGTGTGTGTGGG + Intergenic
1122820003 14:104337447-104337469 GTGTGCATGAGCCTTTCTCTGGG + Intergenic
1122986771 14:105215463-105215485 GTGTGTGTGTGCATGTGTTCTGG - Intronic
1122999368 14:105284148-105284170 TTGTGGACGTGCATGTGTGTTGG - Intronic
1123125975 14:105946265-105946287 ATGTGTGTGTGCGTGTGTCTTGG - Intergenic
1123963218 15:25428880-25428902 GAGTGTATGTGCAGGTGTTTTGG - Intronic
1123974349 15:25538777-25538799 GTCTGCTTGGGCCTGTGTCTTGG + Intergenic
1124054606 15:26230735-26230757 GTGTGCATGTGTGTGTGTTGAGG - Intergenic
1124097390 15:26661263-26661285 GTAGGCATGTGCATGTATGTGGG - Intronic
1124192221 15:27590122-27590144 GTGTGTATGTGAATGAGTGTGGG - Intergenic
1124200182 15:27672709-27672731 GCGTGCATGTGCATGTGTGTGGG - Intergenic
1124250822 15:28105594-28105616 GGGTGTGTGTGCATGTGTGTAGG + Intergenic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124250903 15:28106140-28106162 GTGTGTGTGCGCATGTGTGTGGG + Intergenic
1124250906 15:28106163-28106185 GTGTGTGTATGTATGTGTCTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124250926 15:28106309-28106331 GTGTGTGTATGCATGTGTGTGGG + Intergenic
1124596986 15:31099398-31099420 GAGTGTATGTGTGTGTGTCTGGG - Intronic
1124636187 15:31366387-31366409 GTGTGCCTGTGCCTGTGCATGGG - Intronic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125118019 15:36118553-36118575 GTTTGCATGTGGATTTGTGTGGG + Intergenic
1125194606 15:37031843-37031865 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1125435379 15:39638836-39638858 GTGTGCATGTGTGTGTGTGGTGG + Intronic
1125743556 15:41984111-41984133 GTGTGCAGGTGCGTGTGTGAGGG - Intronic
1125910391 15:43432745-43432767 GTGTGCATGTGTGTGTGTAGTGG + Intronic
1127024394 15:54787012-54787034 TTGTGCATGTACATGTGCGTGGG - Intergenic
1127367628 15:58306313-58306335 GTGGCCTTGTGGATGTGTCTAGG - Intronic
1127550925 15:60037714-60037736 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1127564571 15:60174303-60174325 GTGTGTATGTGCATTTGTAGTGG - Intergenic
1127630031 15:60819742-60819764 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1128039884 15:64562893-64562915 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1128301860 15:66570973-66570995 GTGTGCATGTGTGTGGGTCCAGG + Intergenic
1128585261 15:68843879-68843901 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1128596580 15:68957136-68957158 CTGTGCCTGTTCATGTTTCTGGG + Intronic
1128716715 15:69913964-69913986 GTGTGCATGTGTGTGTGTGTTGG + Intergenic
1128747767 15:70126525-70126547 GTGTGGCTGTGCCTGTGACTTGG + Intergenic
1128791300 15:70435975-70435997 CTGTGCATGTCCATTTGTGTGGG + Intergenic
1129201399 15:74003457-74003479 GTGTGCATGTATGTGTGTGTTGG - Intronic
1129295423 15:74597502-74597524 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1129560366 15:76559928-76559950 GTGTGTATGTGTGTGTGTATGGG + Intronic
1129665484 15:77577269-77577291 GGGTGCATGTGTGTGTGTGTAGG + Intergenic
1129699439 15:77759172-77759194 GTATGCATGTGCGTGTGCATGGG - Intronic
1129710793 15:77819447-77819469 GTGTGCATGTGCGTGTGCGCGGG + Intronic
1129879359 15:78996732-78996754 GTGTGCGTGTGTGTGTGTGTGGG + Intronic
1129894098 15:79090933-79090955 GTGTGCGTGTGTGTGTGTCTGGG - Intergenic
1130125176 15:81087870-81087892 GTGTGCATGTGTGTGTGTGTGGG - Intronic
1130138440 15:81201270-81201292 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1130182301 15:81642869-81642891 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
1130270539 15:82444296-82444318 GCATGCATATGCATCTGTCTTGG + Intergenic
1130462883 15:84171615-84171637 GCATGCATATGCATCTGTCTTGG + Intergenic
1130489791 15:84423172-84423194 GCATGCATATGCATCTGTCTTGG - Intergenic
1130501382 15:84501922-84501944 GCATGCATATGCATCTGTCTTGG - Intergenic
1130520642 15:84658351-84658373 GTGTGGGTGTGCAGGTCTCTGGG - Exonic
1130995957 15:88904342-88904364 GTGCACGTGTGCATGTGTGTGGG - Intronic
1131204692 15:90433400-90433422 GTCTTCATATGCCTGTGTCTGGG + Intronic
1131766539 15:95681804-95681826 GTGTGCATGTGGTGGTGTGTGGG - Intergenic
1132023025 15:98381155-98381177 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1132052888 15:98625005-98625027 GTGTGTGTGTGCATGATTCTAGG + Intergenic
1132097227 15:98996536-98996558 GTGTGTGTGTGCATATGTATAGG + Intronic
1132998607 16:2837787-2837809 GTGTGGATGTGTCTGTGTGTGGG - Intronic
1133039220 16:3051201-3051223 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1133424122 16:5672873-5672895 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1133555136 16:6899299-6899321 GTATGCATGTGTATGTTTCAGGG + Intronic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134107856 16:11496724-11496746 GTGTGCCTATGCATGTGTCCAGG + Intronic
1134308954 16:13058779-13058801 GTGTGAATGTGTATGTGTGGTGG + Intronic
1134331661 16:13256914-13256936 GTGTGTATGTGTATGTTTCTGGG - Intergenic
1134598880 16:15517853-15517875 GTGTGTGTGTGGATGTGTGTGGG + Intronic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135181393 16:20277563-20277585 GTGTGCATGTGGGTGGGTTTGGG + Intergenic
1135227220 16:20671436-20671458 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1135281799 16:21158999-21159021 GTGTGTATGTGTGTGTGTGTTGG - Intronic
1135463458 16:22664843-22664865 GGGTGCATGTGCAAGGGTCCTGG + Intergenic
1135533190 16:23272152-23272174 GTATGCGTATGCATGTGTGTAGG - Intergenic
1135608481 16:23843950-23843972 GTGTGTGTGTGCATGTGTGATGG - Intronic
1135803631 16:25522347-25522369 GTGTGTGTGTGTATGTGTATGGG - Intergenic
1135845491 16:25914635-25914657 GTGTGTGTGTGCACGTGTGTGGG + Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1135875675 16:26197912-26197934 GTGTGCCTGTGTGTGTGTGTGGG - Intergenic
1136020905 16:27439179-27439201 GCGTGAGTGTGCATGTGTCTGGG - Intronic
1136033163 16:27518184-27518206 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1136115184 16:28089968-28089990 GTATGCATGTGCATGCATGTGGG - Intergenic
1136228005 16:28871993-28872015 GTGTGAGTGTGCATGTCTCCAGG + Intronic
1136282065 16:29219318-29219340 GTGTTCGTGTGCATCAGTCTGGG - Intergenic
1137279334 16:46961935-46961957 GTGTGCCTGTTTGTGTGTCTCGG - Intronic
1137458384 16:48635773-48635795 GTGTGTATGTGCGTGTGTGTGGG + Intergenic
1137484938 16:48882854-48882876 TTGTGCATGTTCATTTGTTTTGG + Intergenic
1137501638 16:49015968-49015990 GTGTGCATGTGTGTGTGGTTTGG + Intergenic
1137596914 16:49730125-49730147 GTGTATATGTGTATTTGTCTGGG - Intronic
1137886863 16:52114221-52114243 TTGTGCATGTGCACATGTGTTGG - Intergenic
1138162097 16:54763964-54763986 GTGTGCATGTGTCTGTGTTGAGG - Intergenic
1138248763 16:55486373-55486395 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1138491183 16:57377592-57377614 GCGTGCATGTGCCTGTATTTGGG + Intronic
1138532918 16:57644981-57645003 GTGTGCATGTGTGTGTGCATGGG - Intronic
1138542149 16:57694980-57695002 GTGTGCGTGTTTATGTGTGTTGG + Intronic
1138960887 16:62027896-62027918 ATGTGCACGTGTATGTGTGTGGG - Intronic
1138975541 16:62202820-62202842 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1139296978 16:65909704-65909726 GTGGGCATGACCAAGTGTCTGGG + Intergenic
1139453939 16:67056512-67056534 GTGTGTGTGTGTATGTGTGTAGG + Intronic
1140513583 16:75526225-75526247 GTGTGCATGTGTGTGTGTGGGGG + Intergenic
1140891187 16:79286725-79286747 GTGGGCATTTGCCTCTGTCTGGG - Intergenic
1140896097 16:79325588-79325610 GTGTGTGTGTGTTTGTGTCTGGG - Intergenic
1140946143 16:79770196-79770218 GTGTGTTTGTGCACGTGTATGGG + Intergenic
1141062485 16:80886712-80886734 GTGTGCATGTGCATGGCTGAGGG + Intergenic
1141216425 16:82029252-82029274 GCGTGGATGTGCATGTGTGCAGG - Intergenic
1141225830 16:82113966-82113988 GGGTCCATGTGCATTTGTGTGGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141435089 16:83995539-83995561 GTGTGCATGTGGATAGGTTTGGG - Intronic
1141759699 16:86019825-86019847 GTGTGTGTGTGCATGTGTTCAGG - Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141928885 16:87187306-87187328 GTGTGCATGTGTGTGGGTGTGGG + Intronic
1141928946 16:87187935-87187957 GTGTGCATGTGTACGTGTGTGGG + Intronic
1141929003 16:87188385-87188407 GTGTGCGTGTGCATGTGTGTGGG + Intronic
1141929008 16:87188440-87188462 GTGTACGTGTGCATGTGTGTGGG + Intronic
1142056642 16:88001275-88001297 GCGTGCATGTTGACGTGTCTGGG - Intronic
1142086442 16:88185240-88185262 GTGTTCGTGTGCATCAGTCTGGG - Intergenic
1142224180 16:88869617-88869639 GTGTGTCTGTGCCTGTGTGTTGG + Intergenic
1142257732 16:89023382-89023404 GTGTGCATGTGTGTGAGTGTGGG - Intergenic
1142259135 16:89034400-89034422 GTGTGCATGTGAGTGTGTGCAGG - Intergenic
1142410618 16:89914406-89914428 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410642 16:89914605-89914627 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410646 16:89914649-89914671 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410651 16:89914685-89914707 GTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142454378 16:90209855-90209877 GCATGCATGTGCATGTGTGTTGG - Intergenic
1142951458 17:3484502-3484524 TTGTGTATGTGTATGTGTTTGGG + Intronic
1142956111 17:3523891-3523913 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1143095159 17:4474962-4474984 GTGTGAGTGTGCTTGTGTGTTGG + Intronic
1143168081 17:4908983-4909005 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1143411275 17:6710770-6710792 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1143679091 17:8462808-8462830 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1143747650 17:9005427-9005449 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1143785824 17:9254735-9254757 GTGTAGATGTTCATGTGTCCAGG - Intronic
1143790337 17:9289984-9290006 GAGTGCCTGAGCATGTGTGTGGG + Intronic
1143865525 17:9919999-9920021 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
1144107554 17:11999274-11999296 ATGTGTATGTGCATTTTTCTTGG - Intergenic
1144201809 17:12948713-12948735 GTGTGTGTGTGTATGTGTGTTGG - Intronic
1144213201 17:13032511-13032533 GTTTGCTTGTGCATTTTTCTTGG + Intergenic
1144301989 17:13929724-13929746 ATGTAAATGTGCATGTGTATAGG + Intergenic
1144527611 17:16003694-16003716 GTGTGAGTGTGCGTGTGTGTGGG + Intronic
1144672073 17:17138463-17138485 GGGTGGAAGTGCATGTGTGTGGG - Intronic
1145904814 17:28510309-28510331 GTATCTCTGTGCATGTGTCTGGG - Intronic
1146404880 17:32528461-32528483 GTGTGTGTGTGTATGTGTGTCGG + Intronic
1146845681 17:36180434-36180456 GTGTGCATGTGTGTGTGTGCAGG + Intronic
1146873898 17:36392301-36392323 GTGTGCATGTGTGTGTGTGCAGG + Intronic
1146969846 17:37063722-37063744 GTATGTATGTGCATGTGTATCGG + Intergenic
1147055848 17:37834308-37834330 GTGTGGATGTGGATGTGTGTGGG - Intergenic
1147065492 17:37920572-37920594 GTGTGCATGTGTGTGTGTGCAGG - Intergenic
1147088689 17:38078376-38078398 GTCTGCATGTGCATATGTGGGGG + Intergenic
1147108521 17:38242149-38242171 GTCTGCATGTGCATATGTGGGGG - Intergenic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147455217 17:40533573-40533595 GTGTGTGTGTGTGTGTGTCTCGG + Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585518 17:41652062-41652084 GTATGTGTGTGCATGTGTGTTGG - Intergenic
1147585521 17:41652101-41652123 GTATGTGTGTGCATGTGTGTTGG - Intergenic
1147757225 17:42776846-42776868 GGATGCATGTGCATTTTTCTAGG + Intronic
1148031060 17:44621377-44621399 GTGTGCATGTGGATGGATATGGG - Intergenic
1148136256 17:45293806-45293828 GTGTGCATGTGTGTCTGTGTGGG - Intronic
1148228361 17:45915394-45915416 GTGTGCATGAGCATGTGTGTGGG + Intronic
1148291276 17:46452547-46452569 TTGTGCATGTGCATTTTCCTGGG + Intergenic
1148313463 17:46670250-46670272 TTGTGCATGTGCATTTTCCTGGG + Intronic
1148335186 17:46836118-46836140 GTGTGTGTGTGTGTGTGTCTCGG + Intronic
1148570089 17:48661437-48661459 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1148854514 17:50571418-50571440 GTGTGCGTGTGAATGTGTGCGGG + Intronic
1148855619 17:50577778-50577800 GTGTGCAAGTGCACGTGTGTGGG + Intronic
1149174324 17:53851784-53851806 GCGTGCATGTGTGTGTGTGTAGG + Intergenic
1149200593 17:54181645-54181667 GTGTGCACATGCATGTGTGTGGG + Intergenic
1149965311 17:61156755-61156777 GTGTGCATGTGAATTTTTTTAGG - Intronic
1150105051 17:62456506-62456528 ATGTGCATGTGTGTGTGTCTAGG + Intergenic
1150124606 17:62628031-62628053 GTGTGCGTGTGTGTGTGACTGGG + Intronic
1150134965 17:62690485-62690507 GTGCACATGTGCAAGTGTGTGGG - Intronic
1150556023 17:66254787-66254809 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1151032250 17:70754745-70754767 GTTATCATGTGCATGTCTCTGGG - Intergenic
1151187805 17:72376551-72376573 GTGTGCATGCGCGTGTGTGAGGG - Intergenic
1151377047 17:73696878-73696900 GTTTGTATATGCATGTGTGTGGG - Intergenic
1151497146 17:74465252-74465274 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497150 17:74465324-74465346 GTGTGTATGTGAGTGTGTTTGGG + Intergenic
1151497156 17:74465638-74465660 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497161 17:74465754-74465776 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497163 17:74465804-74465826 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497165 17:74465858-74465880 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151497167 17:74465906-74465928 GTGTGTTTGTGAATGTGTGTGGG + Intergenic
1151516909 17:74602468-74602490 ATGTGCATGTGTGTGTGTTTGGG + Intergenic
1151847962 17:76671402-76671424 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1152036839 17:77878801-77878823 GTGTGTATGTGTATGAGACTGGG + Intergenic
1152056241 17:78029804-78029826 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152088253 17:78232975-78232997 GTGTGCATGTGAGAGTGTGTGGG + Intronic
1152128779 17:78463553-78463575 GTGTGCATGTGTATATGTGCAGG - Intronic
1152158841 17:78654355-78654377 GTGTGTATGTGTATGTATGTGGG - Intergenic
1152235896 17:79138449-79138471 GTGTGTATGTGCATGAGCTTGGG - Intronic
1152470087 17:80486282-80486304 GTGTGCATGTGCAGGGGGCAGGG + Intergenic
1152512413 17:80799364-80799386 GTGTGGATGTGCAGATGTCAGGG + Intronic
1152575459 17:81138581-81138603 GTGTGGGTGTGCACGTGTGTGGG - Intronic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1152882756 17:82829186-82829208 GTGTGCATGTGCACGTCTGCGGG - Intronic
1152997018 18:417037-417059 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153960351 18:10134958-10134980 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153961648 18:10145269-10145291 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153978207 18:10287768-10287790 GTGTGCATGTGAGTGTGTGGGGG + Intergenic
1154351864 18:13590007-13590029 GTGTGGCTGTGCATGTGTATGGG + Intronic
1155061582 18:22233472-22233494 GTGTTCGTGTGCCTGTGTCAAGG + Intergenic
1155253397 18:23972385-23972407 ATTTGGATGTGCATGAGTCTGGG - Intergenic
1155538232 18:26840123-26840145 ATGTGGATGTGGATGTGGCTGGG - Intergenic
1155618738 18:27751312-27751334 GTGTGCATGTGTGTGTGTGGGGG + Intergenic
1155851223 18:30776841-30776863 GTGTGCGTGTGTGTGTGTATTGG + Intergenic
1155867669 18:30985922-30985944 GTGTGCAAGTGCATGTGTGTGGG + Intergenic
1155978645 18:32158381-32158403 GTGTGCCTGTGCTTTTTTCTAGG - Intronic
1156012192 18:32508297-32508319 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1156432676 18:37092501-37092523 GTGTGCATGGGCATCAGTCGTGG - Intronic
1156518282 18:37699370-37699392 GTGTGTATGTGTATGTGTGGTGG + Intergenic
1156684351 18:39626953-39626975 GTGAGCAGGTGCAGGAGTCTGGG + Intergenic
1157195280 18:45615789-45615811 GTGTGCATGTGTGTATGTGTAGG + Intronic
1157405844 18:47422170-47422192 GTGTGAGTGTGTGTGTGTCTAGG - Intergenic
1157498813 18:48175499-48175521 CAGTGTATGTGCATGTGTATGGG + Intronic
1157539001 18:48485852-48485874 GTGTGGCTGTCCATGTGGCTTGG - Intergenic
1157701043 18:49761729-49761751 GTGTGCATGGGGATGTGTGGAGG - Intergenic
1157701081 18:49761842-49761864 GTGCGCATGTGGATGTGTGGGGG - Intergenic
1157802206 18:50629955-50629977 TTAAACATGTGCATGTGTCTGGG + Intronic
1158008432 18:52700145-52700167 GTGTGCATGTGTGTGTGTGTGGG - Intronic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1158120004 18:54038434-54038456 GTGTGCATGTGTGTGTGTGGGGG - Intergenic
1158831458 18:61283932-61283954 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1158847177 18:61456842-61456864 GTGTGCAGGTGGTTGTCTCTTGG + Intronic
1158881738 18:61785412-61785434 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1159228271 18:65569798-65569820 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1159252401 18:65896708-65896730 GTGTGTATGTGTGTGTGTATGGG - Intergenic
1159506100 18:69338059-69338081 GTGTGCATGTGTATGGATGTAGG - Intergenic
1159520919 18:69522223-69522245 GTGTGTGTGTGTATGTGTGTGGG - Intronic
1159532394 18:69670976-69670998 GTGTGCGTGTGTGTGTGTGTTGG - Intronic
1159870962 18:73759438-73759460 GTCTGCTTGTGCAGTTGTCTGGG - Intergenic
1159904416 18:74077163-74077185 GTGTGCATATGCAGGTGGCCAGG - Intronic
1160004512 18:75059988-75060010 GTCTGCCTGGGCACGTGTCTGGG - Intronic
1160008492 18:75086835-75086857 GTGTGAATATGCATGTGTGTGGG + Intergenic
1160243369 18:77138171-77138193 GTGAGCATGTGGATGGCTCTGGG + Intergenic
1160353221 18:78203118-78203140 ATGTGCACGTGCATGTATTTTGG + Intergenic
1160523443 18:79521995-79522017 GTGTGTCTGTGCATGTGTGGGGG + Intronic
1160572601 18:79828729-79828751 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572603 18:79828784-79828806 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572606 18:79828842-79828864 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572609 18:79828951-79828973 GTGTGCATGTGTCTGTATGTGGG + Intergenic
1160572612 18:79829009-79829031 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572614 18:79829064-79829086 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572617 18:79829122-79829144 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160572620 18:79829180-79829202 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1160575574 18:79851804-79851826 GTGTGAATGTGCATGTGAATGGG + Intergenic
1160656250 19:272261-272283 GTGTGTATGTGTGTGTGTGTGGG - Intergenic
1160686036 19:437014-437036 GTGTGCATGTGTGTGGGGCTTGG - Intronic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1160921910 19:1524615-1524637 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1161227968 19:3156159-3156181 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1161248269 19:3267103-3267125 GTGTGCGTGTGCGTGTGTGTTGG + Intronic
1161755759 19:6133012-6133034 GTGTGCATATGTATGTGTCTTGG + Intronic
1161812808 19:6480156-6480178 GTCGGCATGTGCATGACTCTGGG + Intronic
1161929878 19:7332058-7332080 GTGAACAGGTGCATGTGTCTGGG + Intergenic
1162468448 19:10857252-10857274 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1162588909 19:11578215-11578237 GTGTCCATGTGTGTGTGCCTGGG + Intronic
1162653746 19:12112595-12112617 GTGTCTATCTTCATGTGTCTAGG - Intronic
1162777941 19:12990777-12990799 GTGTGCCTGAGAGTGTGTCTGGG - Intergenic
1162847805 19:13406916-13406938 GTGTGAATGTGCTTGTGTGTTGG - Intronic
1162926844 19:13934570-13934592 GTGTGCATGTGACTGTGCGTAGG + Intronic
1163068274 19:14815805-14815827 GTGTGTGTGTGTCTGTGTCTGGG + Intronic
1163076176 19:14893821-14893843 GTGTGTGTGTGCACGTGTGTGGG - Intergenic
1164519480 19:28967630-28967652 TTGTGAGTGTGCATGTGTGTGGG + Intergenic
1164527699 19:29023942-29023964 GTGCACATGTGCAGGTGTCTGGG + Intergenic
1164649470 19:29881641-29881663 GTGTGCATCTGCAAATGTCGTGG + Intergenic
1165025717 19:32959784-32959806 GTGTGCATGTGTACCTGTGTGGG - Intronic
1165072716 19:33264816-33264838 GTGTGTCTGTGCATGGGCCTGGG - Intergenic
1165073661 19:33269347-33269369 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165347853 19:35260024-35260046 GTGTGAATGAGCACGTGACTGGG + Intronic
1165391122 19:35539560-35539582 GTGTGTATTTGCATGTGTGTGGG - Intronic
1165924317 19:39317911-39317933 ATGTGCGTGTGCATGGGTGTGGG - Intergenic
1166232427 19:41432894-41432916 GCGTGCATGTGTGTGTGTATAGG + Intronic
1166346519 19:42169752-42169774 GTGTGCGTGTGTGTGTGTGTCGG + Intronic
1167109705 19:47452474-47452496 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1167140383 19:47646420-47646442 GTGTCTGTGTGCATGTGTGTCGG - Intronic
1167660906 19:50795307-50795329 GTGTGCATGTGTCTGTGTGACGG + Intergenic
1167675920 19:50885468-50885490 GTGTGCATGTACATGGGTGGTGG + Intergenic
1167679463 19:50910227-50910249 GTGTGCATGGGCTTGTGGCTTGG - Intronic
1168104599 19:54158999-54159021 GTGTTTGTGTGTATGTGTCTAGG + Intronic
1168109346 19:54183380-54183402 GTGAGGGTGGGCATGTGTCTGGG - Intronic
1168145394 19:54417167-54417189 GTGTGCATGTGAGTGTGTAATGG - Intronic
1168145405 19:54417286-54417308 GTGTGCATGTGAGTGTGTAATGG - Intronic
1168304652 19:55428997-55429019 GTGTGCATTTGCATTTGTTGGGG + Exonic
924991832 2:319126-319148 GTGTGCGTGGGCACGTGTGTGGG + Intergenic
924991836 2:319150-319172 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
925091437 2:1159259-1159281 GTGTGCATGTGTGTGTATGTGGG + Intronic
925420467 2:3706554-3706576 GTGTGTGTGTGTATGTGTTTAGG + Intronic
925513463 2:4653311-4653333 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
925708335 2:6712707-6712729 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
925904004 2:8528438-8528460 GTGTGTATGAGCATGGGTGTGGG - Intergenic
925999340 2:9317711-9317733 GTGTGAATGTGATTGTGTATGGG - Intronic
926054407 2:9766060-9766082 GTGTGCATGTGGGTGTGTAGAGG - Intergenic
926223480 2:10951494-10951516 GTGTGATTGTGTGTGTGTCTGGG + Intergenic
926358779 2:12065807-12065829 CTGTGCATGTGCATGAGCATGGG - Intergenic
926392204 2:12404866-12404888 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
926469824 2:13240208-13240230 GTGTGCATATGCATATGTTGGGG + Intergenic
926888336 2:17617860-17617882 ATGTGCATGTGCATGTATGCAGG - Intronic
926966380 2:18417893-18417915 GTATGCATGTGTATGTATATGGG - Intergenic
927011845 2:18912088-18912110 GTGTGAGTGTGTATGTGTGTTGG + Intergenic
927155777 2:20220350-20220372 GTGTGTGTGCGCATGTGTATGGG - Intronic
927305290 2:21564454-21564476 GTGTACATGTACATGTGTTAGGG + Intergenic
927383145 2:22501823-22501845 GTGTGCAGATGCATCTGTGTGGG - Intergenic
927477140 2:23422807-23422829 GTCTGCATGTGCAGGTGGGTGGG + Intronic
927497991 2:23563515-23563537 GTGCACATGTGTGTGTGTCTAGG + Intronic
927623804 2:24691025-24691047 GTGTGGATGTGCACCTTTCTGGG - Intronic
927819201 2:26247773-26247795 GTATGCATGAGGATGTGTGTAGG + Intronic
927923857 2:26995825-26995847 GTGTGTATGTGTGTGTGTTTTGG + Intronic
928094694 2:28396785-28396807 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
928103684 2:28453868-28453890 GCGTGCATGTGCGTGTGCATAGG + Intergenic
928136558 2:28692315-28692337 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928573388 2:32629885-32629907 GTGTGTATGTGTGTGTGTGTGGG + Intronic
928664929 2:33540588-33540610 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
928815263 2:35286709-35286731 GTGTGCGTGTGTATGTATGTAGG - Intergenic
928937674 2:36696734-36696756 GTGTGTGTGTGTATGTGTGTGGG + Exonic
929443415 2:41984116-41984138 GTGTGCATGTGTGTGTGTTTGGG + Intergenic
929475376 2:42241856-42241878 GTGTGTATGTGTGTGTGTCGGGG + Intronic
929536221 2:42786053-42786075 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
929778255 2:44941906-44941928 GTGTGTGTGTGGATGTGTGTGGG + Exonic
930004034 2:46881927-46881949 GTGTGCTGGTGCATGTGTTTGGG + Intergenic
930284208 2:49407760-49407782 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
930537193 2:52657742-52657764 GTGTGTATGTGTGTGTGTGTAGG - Intergenic
930574426 2:53128354-53128376 GTGTGTATGTGTTTGTTTCTAGG - Intergenic
930846213 2:55907249-55907271 TTGTACATATGCATGTGTATAGG + Intronic
930874257 2:56195947-56195969 GTGTGCATATGTGTGTGTTTTGG - Intronic
931145326 2:59510561-59510583 GTGTGTATGTGTGTGTGTATTGG - Intergenic
931169211 2:59785055-59785077 GTGTGTATGTGTATATGTGTAGG + Intergenic
931239645 2:60440806-60440828 GTATGGGTGTGCATGTGTGTTGG - Intergenic
931722220 2:65075432-65075454 GTGTGCGTGTGTATGTATTTGGG + Intronic
931937449 2:67214596-67214618 GTGTGGGTGTGTATGTGTCGGGG - Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932216339 2:69968748-69968770 GTCTGCATGGGCCTGAGTCTTGG + Intergenic
932263871 2:70349674-70349696 GTGTGCGTGTGTGTGTGTGTGGG - Intergenic
932481446 2:72041886-72041908 GTGTGCAGGTGTGTGTGTGTTGG - Intergenic
932493065 2:72133685-72133707 GTGTGCGTGTGTATGTGTGGGGG + Intronic
932514930 2:72336015-72336037 GTGTGTATGTGTGTGTGTATAGG - Intronic
932926513 2:75981256-75981278 GTGTGCGTGTGCGTGTGTGCAGG - Intergenic
933104104 2:78300348-78300370 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
933176298 2:79177405-79177427 GTGTGTGTGTGTATGTGTTTAGG - Intergenic
933201322 2:79453107-79453129 GTGTGCATTCACATCTGTCTTGG + Intronic
933253261 2:80052345-80052367 TTGTATATGTGCATGTGGCTGGG - Intronic
933259525 2:80116488-80116510 GTGTGCATATGCATATGCGTGGG + Intronic
933439256 2:82290058-82290080 GCATGTATGTGCATGTGTATGGG + Intergenic
933760174 2:85667275-85667297 GTGGGCAGCTGCATGTGCCTTGG - Intronic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
934092443 2:88564548-88564570 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
934127310 2:88909044-88909066 GTGTGTATGTGTGTGTGTATAGG + Intergenic
934972770 2:98776234-98776256 GCGTGCATGTGTGTGTGTTTTGG + Intergenic
935079461 2:99778016-99778038 ATGTGCATGTCCATATGGCTGGG + Intronic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935169019 2:100595931-100595953 GTGTGTGTGTGGGTGTGTCTGGG - Intergenic
935276096 2:101476436-101476458 GTGTGTGTGTGCATATGTTTTGG - Intergenic
935446266 2:103159627-103159649 GTGTGCATGTGTATGTGCCTGGG + Intergenic
935715500 2:105935856-105935878 GTGTTTATGTGGATGTGTGTTGG - Intergenic
935715526 2:105936021-105936043 GTGTTTATGTGGATGTGTGTTGG - Intergenic
935715665 2:105936941-105936963 GTGTATATGTGTATGTGTGTTGG - Intergenic
935816091 2:106847254-106847276 TTGTGGATGTGCATTAGTCTGGG + Intronic
936039104 2:109135648-109135670 GTGTGGATGTGGATGTGCATGGG + Intronic
936075689 2:109400375-109400397 GCGTGCATGTGTATATGTGTAGG - Intronic
936339334 2:111617486-111617508 GTGTGTATGTGCGTGTGTATGGG - Intergenic
936621630 2:114105277-114105299 GTGTGTATGTGTCTGTGTATGGG + Intergenic
936725909 2:115315246-115315268 GTGTGCATGTGTGTGTGTGCAGG - Intronic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
936974237 2:118203281-118203303 GTGTGCGTGTGTGTGTGTGTTGG - Intergenic
937054478 2:118921627-118921649 TTGTGGATGTGCTTGTGTCAGGG - Intergenic
937108608 2:119343443-119343465 GTGTGCATATGCGTGTGTATGGG - Intronic
937187416 2:120057429-120057451 ATGTGTATGTGCATTTTTCTAGG - Intronic
937230455 2:120395476-120395498 ATGCGCATGTGCGTGTGTCAAGG - Intergenic
937324768 2:120983975-120983997 GTGTGCATGTTTATGAGTCCAGG + Intronic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937817392 2:126266859-126266881 TTGTGTATGTGCGTGTGTGTTGG - Intergenic
937870682 2:126783851-126783873 GTGTGCATGTGCATGAACTTGGG - Intergenic
937907945 2:127061474-127061496 GTGTGCATGTGTGTGTGTGAGGG - Intronic
938558276 2:132446586-132446608 TTGTGCCTCTGCCTGTGTCTTGG + Intronic
938676933 2:133646076-133646098 GTGTCTATGTGTATGTGTATAGG + Intergenic
938839481 2:135145383-135145405 GTGTGTATGTGTGTGTGTGTTGG - Intronic
938937848 2:136143296-136143318 GTGTGTGTGTGCAAGTGTGTGGG + Intergenic
939007199 2:136803152-136803174 ATGTGCATGTGTGTGTGTGTGGG - Intronic
939127522 2:138195077-138195099 GTGTGCATGTGTGTGTGTGTTGG - Intergenic
939156867 2:138536345-138536367 GTGTGCGTGTGTGTGTGTGTGGG - Intronic
939178151 2:138774640-138774662 CTGTGAGTGTGTATGTGTCTTGG - Intronic
939499030 2:142959110-142959132 GTGTGAGTGTGTATGTGTGTGGG - Intronic
940001354 2:148969451-148969473 GTGTGTGTGTGTATGTGTGTGGG + Intronic
940205455 2:151197071-151197093 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
940797853 2:158099496-158099518 GTGTGTGTGTGCATGTGTAAGGG + Intronic
941097759 2:161259907-161259929 GTGTGTGTGTGTATGTGTATGGG + Intergenic
941746606 2:169093327-169093349 GTGTGCGTGTGTGTGTGTTTAGG - Intronic
941881943 2:170489651-170489673 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
941976887 2:171415238-171415260 CTATGCATATGCATGTTTCTTGG - Intronic
942210126 2:173661695-173661717 TTTTGCATCTGCAAGTGTCTGGG - Intergenic
942228001 2:173833575-173833597 TTTTGCCTGTGCATGAGTCTCGG - Intergenic
942432274 2:175925144-175925166 GTGTGGATGTGCGTGTGTCAGGG - Exonic
942561672 2:177226535-177226557 GTGTGTGTGTGCATGTGTGGAGG - Intergenic
942666626 2:178326204-178326226 GGGTGAGTGTGCATGTGTGTGGG - Intronic
943093538 2:183402200-183402222 GTGGGAAGGTGTATGTGTCTAGG + Intergenic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
944330374 2:198458386-198458408 CTGTGCATCTGCAGGTGGCTGGG - Intronic
944351561 2:198733669-198733691 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
944366485 2:198926817-198926839 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
945063326 2:205927092-205927114 TTGTGCAGGTGCGTGTCTCTAGG + Intergenic
945117862 2:206426871-206426893 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
945213533 2:207409303-207409325 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
945219355 2:207468349-207468371 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
945338401 2:208619833-208619855 GTGTGTGTGTGCATGTGTGCTGG + Intronic
945368681 2:208989285-208989307 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
946414980 2:219535451-219535473 GTGTGGGTGTGTATGTGTGTGGG + Intronic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
946740077 2:222792558-222792580 TTTTGCATTTGCATGTCTCTGGG - Intergenic
946817704 2:223595882-223595904 GCGTGTGTGTGCGTGTGTCTGGG - Intergenic
946838807 2:223799204-223799226 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
947211106 2:227709593-227709615 GTGTGCAAGTGGGTGTGTATGGG - Intronic
947591706 2:231389612-231389634 GTGTGTGTGTTCATGCGTCTGGG + Intergenic
947735644 2:232453697-232453719 GTATTCGTGTGCATGTGTGTGGG - Intergenic
947750394 2:232529041-232529063 GTGTGCACGTGTGTGTCTCTGGG - Intronic
947882480 2:233530201-233530223 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
947968334 2:234301070-234301092 ATGTGCATGTACATGTCTATGGG - Intergenic
948156092 2:235783034-235783056 GTGTGTGTGTGTGTGTGTCTAGG + Intronic
948231759 2:236354335-236354357 GTGTGCATGTGTGTGTGTGGGGG + Intronic
948271009 2:236673156-236673178 GTGTGCATGTGTGTGTGAGTGGG + Intergenic
948327659 2:237139243-237139265 ATGTGCACGTGCATGTGTATTGG - Intergenic
948354217 2:237364819-237364841 GTGTGCATGTGTGGGTGTGTGGG + Intronic
948354219 2:237364835-237364857 GTGTGGGTGTACATGTGTGTGGG + Intronic
948354221 2:237364861-237364883 GTATGTGTGTGCATGTGTATGGG + Intronic
948383258 2:237565628-237565650 GTGTAGATGTGTATGTGTGTAGG - Intergenic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948741125 2:240046611-240046633 CTGTGGATGTGCCTGAGTCTGGG - Intergenic
948758554 2:240174531-240174553 GTGTGCGTGTGTGTGTGTTTTGG + Intergenic
948950900 2:241250701-241250723 CTCTGCGTGTGCATGTGTTTGGG - Intronic
948969782 2:241416017-241416039 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
948991527 2:241558050-241558072 GTGTGTGTGTGTGTGTGTCTCGG - Intergenic
949085836 2:242154510-242154532 GCATGCATGTGCATGTGTGTTGG - Intergenic
1169205625 20:3738848-3738870 GTGTGTGTGTGCATGTGTGCAGG + Intronic
1169580516 20:7018044-7018066 GTGTGTGTATGCATGTGTTTTGG + Intergenic
1169772276 20:9214556-9214578 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1169895083 20:10496171-10496193 CAGTGCTTATGCATGTGTCTGGG + Intronic
1170292387 20:14785186-14785208 GTGTGCATGCGTGTGTGTGTGGG - Intronic
1170932840 20:20784309-20784331 GTGTGTATGTGCATGTGATGCGG + Intergenic
1171010497 20:21506686-21506708 GTGTGTGTGTGTGTGTGTCTCGG + Intergenic
1171030387 20:21671218-21671240 CTGTATATGTGCATGTGTGTGGG - Intergenic
1171030391 20:21671243-21671265 GTGTGAATGTGCAAGTGTGGGGG - Intergenic
1171131200 20:22654264-22654286 GTGAGCATGTGCGTGTGTGTAGG - Intergenic
1171266186 20:23773821-23773843 CTGTGCATGTACATGTGAGTAGG - Intergenic
1171275856 20:23855986-23856008 GTGGGCATGTGCCTGAGGCTGGG + Intergenic
1171275924 20:23856359-23856381 GTGTGCATGTGGCTGTGTGGGGG - Intergenic
1171275938 20:23856458-23856480 TTGTGCATGTACATGTGAGTAGG - Intergenic
1171283408 20:23919422-23919444 GTGGGCAGGTGCATGAGGCTGGG + Intergenic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1171448406 20:25220409-25220431 CTGTGCAGGTGCATATGGCTGGG + Intronic
1171523176 20:25791176-25791198 GTGTGCATGTGTGTGTGTGTTGG - Intronic
1171553650 20:26064707-26064729 GTGTGCATGTGTGTGTGTGTTGG + Intergenic
1171813650 20:29764189-29764211 GTGTGCCTGTGTGTGTGTCGGGG - Intergenic
1171979359 20:31616675-31616697 GTGTGAATGTGTATTTGTCTTGG - Intergenic
1172099388 20:32476081-32476103 GAGTGCGTGTGCCTGTGTGTGGG - Intronic
1172311865 20:33924672-33924694 GTGTGCGCGTGCATGTGTGATGG + Intergenic
1172430853 20:34890363-34890385 GGGTGCATGTGTATATGTATGGG + Intronic
1172502792 20:35438895-35438917 GTGTGCCTGTGTGTGTGTATTGG + Intronic
1172843177 20:37914335-37914357 GTGTATGTGTGCATGTGTGTGGG + Intronic
1173044027 20:39492288-39492310 GGGTGCATACGCATGTGTTTTGG + Intergenic
1173181708 20:40811056-40811078 GTGTGCACATGCATGTGTGTAGG - Intergenic
1173290803 20:41713323-41713345 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1173418944 20:42883624-42883646 GTGTGCATATGCATGTGTATGGG - Intronic
1173418964 20:42883751-42883773 GGGTGTGTGTGCATGTGTATGGG - Intronic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1174146800 20:48458034-48458056 GTTTGCATGCACATGTGTCCAGG + Intergenic
1174308778 20:49634295-49634317 GTGTGTGTGTGTATGTGTGTGGG - Exonic
1174871248 20:54185040-54185062 GTGCGCATGTGGGTGGGTCTGGG - Intergenic
1174957746 20:55118744-55118766 GTGTATATGTGCATGTGTGTGGG - Intergenic
1174997287 20:55584371-55584393 GGATGCATGTGTATGTGTGTGGG + Intergenic
1175390384 20:58623537-58623559 GTGTGCACGTGTGTGTGTATTGG + Intergenic
1175430056 20:58895218-58895240 GTGTGAATGTTCATGTATCAGGG + Intronic
1175481205 20:59312481-59312503 GTGTGCAGGTGCCTGTGTTAGGG + Intronic
1175485255 20:59341364-59341386 GTGTGCATGTGTGTGTGGGTGGG + Intergenic
1175485259 20:59341458-59341480 GTGTGCATGTGTGTGTGGGTGGG + Intergenic
1175562744 20:59944968-59944990 ATGTGCATGTGCTTGTGTTTTGG - Exonic
1175710305 20:61215097-61215119 GTGTACGTGTGTGTGTGTCTTGG - Intergenic
1175741656 20:61423936-61423958 GTGGGCATGTGCCTGTGTACAGG - Intronic
1175758567 20:61545771-61545793 GGGTGTGTGTGCATGTGTTTGGG + Intronic
1175758620 20:61546100-61546122 GGGTGTGTGTGCATGTGTGTGGG + Intronic
1175850435 20:62088128-62088150 GAGTGCATGTGAGTGTGTGTAGG - Intergenic
1176020013 20:62957801-62957823 GTGTGCAAGTGTGTGTGTATGGG + Intronic
1176167862 20:63683482-63683504 GCATGCATGTGCACGTGCCTGGG - Intronic
1176176772 20:63730974-63730996 GTGTGTGTGTGTGTGTGTCTCGG + Intronic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176183476 20:63765115-63765137 GTGTGCGTGTGTGTGTGTGTGGG + Intronic
1176791034 21:13320102-13320124 CTGTGCATTTGCATATGTTTGGG + Intergenic
1177114020 21:17063868-17063890 GTGCGTATGTGTATGTGTGTTGG + Intergenic
1177306445 21:19323989-19324011 GTGTGAATGTGTATGTGTGTAGG - Intergenic
1177339120 21:19776430-19776452 GTGTGTGTGTGTATGTGTTTTGG + Intergenic
1177859561 21:26437145-26437167 GTGTGTATGTGTTTGTGTTTCGG + Intergenic
1178118763 21:29446230-29446252 ATGTGAGTGTGCATGTGTGTGGG - Intronic
1178814705 21:35918189-35918211 GTGTGCATATGTGTGTGTATGGG - Intronic
1178814852 21:35919800-35919822 GTGTGTATTTGTGTGTGTCTGGG - Intronic
1178843233 21:36155447-36155469 TTGTGTATATGCATGTTTCTAGG - Intergenic
1179062469 21:37991707-37991729 GTGTGAATGTGCATGTGTAAGGG - Intronic
1179107708 21:38418285-38418307 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1179270783 21:39849465-39849487 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1179317500 21:40257243-40257265 GTGTGCAGGAGGATGTGTGTAGG - Intronic
1179453884 21:41485100-41485122 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1179467370 21:41585560-41585582 GTATGGATGTGTATGTGTGTGGG - Intergenic
1179532068 21:42026474-42026496 GTGTACATGTGTATGTGTGTGGG + Intergenic
1179574673 21:42300312-42300334 GTGCACATGTGCTTGTGTGTAGG - Intergenic
1179606659 21:42520635-42520657 GTGTGTGTGTGCGTGTGTGTGGG + Intronic
1179728670 21:43354981-43355003 GTGTGCGTGTGCATCTGTGGTGG - Intergenic
1179728685 21:43355071-43355093 GTGTGCGTGTGCATCTGTGGTGG - Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179898856 21:44378538-44378560 GTGTGCATGAGCATCGGCCTGGG - Intronic
1179903016 21:44403455-44403477 GTGTGCATGTGTGTGTGTGTTGG - Intronic
1179966684 21:44810931-44810953 GTGTGCATGTGTGTGGGTGTGGG - Intronic
1179966686 21:44810937-44810959 GTGGGTGTGTGCATGTGTGTGGG - Intronic
1179966702 21:44811093-44811115 GTGTGCATGTGTGTGTATGTGGG - Intronic
1180108456 21:45634974-45634996 GTGTGCATGTGTATGTGCTGTGG + Intergenic
1180172839 21:46068990-46069012 GTGTGTATGCACATGTGCCTGGG + Intergenic
1180172842 21:46069016-46069038 GTGTGTCTGTGCATGTCCCTGGG + Intergenic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181461998 22:23091089-23091111 GTGTGCAGCTGCATGTGTACTGG - Intronic
1181713558 22:24707163-24707185 GTGTGACTGTGAATGTGTGTGGG - Intergenic
1182203768 22:28601773-28601795 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
1182221230 22:28760533-28760555 GTGTGCCTGTGTGTGTGTGTTGG - Intergenic
1182279774 22:29211224-29211246 GTGTGTATGTGAATGTGTGAGGG + Intronic
1182382579 22:29904824-29904846 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1182492925 22:30685576-30685598 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1182623318 22:31629636-31629658 GTGTGCATGAGGGTGTGTGTAGG + Intronic
1182667255 22:31968806-31968828 GTGTGTGTGTGCGTGTGTGTTGG - Intergenic
1182903097 22:33915235-33915257 GTGTGCATATGTGTGTTTCTTGG - Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183012534 22:34958695-34958717 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1183228967 22:36569031-36569053 GTGTGGATGTGGGTGTGTTTGGG - Intronic
1183278140 22:36914208-36914230 ATGTGCATGTGCGGATGTCTGGG + Intronic
1183370122 22:37427436-37427458 GTGTGTCTGTGTGTGTGTCTGGG + Exonic
1183474503 22:38028604-38028626 GTATGCACGTGCATGTCTCTGGG + Intronic
1183540173 22:38425222-38425244 GTGTGGATCTGCATGTATGTAGG + Intergenic
1183617533 22:38954610-38954632 GTGGGCATCTGGGTGTGTCTGGG + Intronic
1183721325 22:39563306-39563328 GTGTGCATATCTATGTGTCTGGG + Intergenic
1184707696 22:46225680-46225702 GTGTCCATGTGCATGTATGGGGG - Intronic
1184739593 22:46419792-46419814 GAGTGCATGTGCATGGGTGAGGG - Intronic
1184821000 22:46909285-46909307 GTGTGTGTGTGTATGTGTATAGG - Intronic
1184924626 22:47628315-47628337 GTGTGCATGTGTGTGTGTTGTGG + Intergenic
1184924637 22:47628460-47628482 GTGTGCATGTGAGTGTGTGTTGG + Intergenic
1184947573 22:47814879-47814901 GTGTGCATCTGCATGTGAACAGG + Intergenic
1185203785 22:49524897-49524919 GTGTGCATGTGGGTGTGTACGGG - Intronic
1185285607 22:49998482-49998504 GTGTGGATATGCATGTGCATGGG + Intronic
1185285656 22:49998837-49998859 GTATGTGTGTGCATGTGTATGGG + Intronic
1185285660 22:49998885-49998907 ATGTGTGTGTGCATGTGTATGGG + Intronic
1185285664 22:49998921-49998943 GGGTGTCTGTGCATGTGTATGGG + Intronic
1185293670 22:50041814-50041836 CACTGCATGTGCCTGTGTCTGGG - Intronic
949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG + Intronic
949570258 3:5285573-5285595 GTGTGCATGTGCATGGCTCCAGG + Intergenic
949578935 3:5366900-5366922 GTAAGCATGTGCATGTATATGGG - Intergenic
949580129 3:5379396-5379418 GAGTGCTTGTTCATGTTTCTTGG + Intergenic
949706246 3:6820730-6820752 CTGTGCTTGTGTGTGTGTCTTGG - Intronic
949715502 3:6926069-6926091 GGGTGTACGTGCATGTGTGTGGG - Intronic
949791516 3:7797301-7797323 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
949867252 3:8556410-8556432 GTGTGTATGTGTGTGTGTGTTGG + Intronic
950040827 3:9918104-9918126 GTGTACACGTGAGTGTGTCTGGG + Intronic
950127290 3:10517727-10517749 CTGTGCATGTGCAAGGCTCTGGG - Intronic
950508551 3:13411636-13411658 GTCGGCAGGTGCAGGTGTCTAGG - Intronic
950539198 3:13599860-13599882 GTGGGCATGTGCATGTGACATGG + Intronic
950539913 3:13605809-13605831 TGCTGCATGTCCATGTGTCTAGG - Intronic
950587026 3:13900271-13900293 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
950618972 3:14187200-14187222 GTGCACATGTGCATTTCTCTGGG + Intronic
950633061 3:14296952-14296974 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
950862958 3:16166569-16166591 GTGTGCGTGTGTGTGTGTGTGGG - Intergenic
951306070 3:21064301-21064323 GTGTGTATGTGTATATGTATAGG + Intergenic
952067394 3:29587558-29587580 GTGTCTGTGTGTATGTGTCTTGG + Intronic
952089056 3:29862609-29862631 GTGTGTGTGTGCATGTGTGGTGG + Intronic
952100212 3:30002388-30002410 GTGTGTATGTGTGTGTGTGTTGG - Intronic
952190264 3:31015469-31015491 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
952618945 3:35312508-35312530 GTGTATGTGTGCATGTGTGTGGG + Intergenic
952825094 3:37518104-37518126 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
952907939 3:38155581-38155603 GTGTGCCTGTGTGTGTGTGTTGG + Intergenic
953246177 3:41195802-41195824 GTGTGCACGTGCGTGTGTTGCGG + Intronic
953412908 3:42700328-42700350 GTGTGTTTGTGTGTGTGTCTGGG + Intronic
953563457 3:44012432-44012454 GTGTGCATTTGCACGTGTGTGGG - Intergenic
953626034 3:44572430-44572452 GTGTGAATGTGTGTGTATCTAGG + Intronic
953724860 3:45388895-45388917 GTGTATATGTGCATTTTTCTGGG - Intronic
953909411 3:46884105-46884127 GTGTGCATGTGTGTGTGTGAGGG - Intronic
954089415 3:48272526-48272548 GTGTGTATGTGTGTGTGTTTAGG + Intronic
954400129 3:50315118-50315140 GTGTGTGTGCGCATATGTCTGGG + Intergenic
954424286 3:50435176-50435198 GTGTGCACGTGCCTGCGTGTTGG + Intronic
954616010 3:51968840-51968862 GTGTGCAAGTGCTTGTGTGGAGG + Exonic
954688032 3:52381105-52381127 GTGTGTGTGTGTATGTGACTGGG + Intronic
954704713 3:52473276-52473298 GTGTGCTTGGGCAGGTGGCTTGG + Intronic
954966620 3:54617158-54617180 ATGTGGAAGTGCATGTGTTTTGG + Intronic
955089420 3:55734574-55734596 GTGTTTATGTGCATGTGGCTGGG - Intronic
955143756 3:56295494-56295516 GTCTGCATTTACATTTGTCTAGG - Intronic
955566218 3:60249685-60249707 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
955711660 3:61785858-61785880 GTGTGTATGTGTCTGTGTATTGG - Intronic
955772885 3:62404282-62404304 GCGTGCATGTGCGTGTGTATTGG - Intronic
956321003 3:67996232-67996254 TGGTGCATGTGCAGGTGTTTAGG + Intergenic
956357382 3:68409119-68409141 CTGTACATGTACATGTGTGTGGG - Intronic
956609447 3:71107349-71107371 GTGTTCATGTGCGTTTTTCTGGG + Intronic
956658387 3:71575440-71575462 GTGTGTATGTGTGTGTGTGTAGG - Intronic
956715158 3:72072814-72072836 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
956981727 3:74646981-74647003 GTGTACATGTGTATGTATATAGG - Intergenic
957031658 3:75249348-75249370 GTGTGCAAGTTCAGGGGTCTTGG + Intergenic
957254138 3:77814636-77814658 GTGTGCCTGTGTGTGTGTGTGGG + Intergenic
957376307 3:79363659-79363681 GTGTGCATGTGAATGCCTGTGGG - Intronic
957542925 3:81599320-81599342 GTGTGCGTGTGTGTGTGTGTAGG + Intronic
957894357 3:86402121-86402143 GTGTGCCTGTGTGTGTGTGTTGG + Intergenic
957982807 3:87532509-87532531 GTGTGGTTGTGTATGTGTATGGG - Intergenic
958973077 3:100634996-100635018 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
959487637 3:106945768-106945790 GTGTGTGTGTGTATGTGTATAGG - Intergenic
959751488 3:109841842-109841864 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
959929719 3:111966505-111966527 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
960165916 3:114401079-114401101 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
960465930 3:117996818-117996840 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
960535924 3:118814089-118814111 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
960812619 3:121639008-121639030 GTGTGCGTGTGTGTGTGTGTTGG - Intronic
960988137 3:123293522-123293544 GTGTGCATGTGCGTGTGTGTAGG - Intronic
961389465 3:126543768-126543790 GTGTGAGTGTGGGTGTGTCTTGG + Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406558 3:126683839-126683861 GTGTGTGTGTGCGTGTGTGTAGG + Intergenic
961628973 3:128282536-128282558 GTGCACATGTGCACGTGTCCTGG - Intronic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
961683236 3:128612796-128612818 GTGTGCCTCTGCATGCCTCTGGG + Intergenic
961867729 3:129966088-129966110 ATGTGTATATGCATGTGTATGGG - Intergenic
962221653 3:133569432-133569454 GTGTGTGTGTGTCTGTGTCTAGG + Intergenic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962344340 3:134608488-134608510 GTGTGCATGTGGATGAGTGGAGG - Intronic
962532854 3:136299524-136299546 GTATGTATATGCATGTGTATAGG + Intronic
962532866 3:136300047-136300069 GTGTTGATATGCATGTGTGTGGG - Intronic
962581069 3:136798447-136798469 GTGTGCGTGTGTGTGTGTGTTGG - Intergenic
962817377 3:139014169-139014191 ATGTGTATGTGTGTGTGTCTGGG - Intronic
962975166 3:140439886-140439908 GTGTGCATGTTTATATGTCTGGG + Intronic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963075860 3:141345710-141345732 GTGTGTGTGTGGGTGTGTCTTGG + Intronic
963265553 3:143236879-143236901 GTGTTCGTGTGTATGTGTGTGGG + Intergenic
963431283 3:145207618-145207640 GTGTGTGTGTGCATGTGTGCGGG + Intergenic
963741123 3:149082858-149082880 GTGAGCATGTGCATGTAAATTGG - Intronic
963852443 3:150222157-150222179 GTGTGTGTGTGCATCTGTGTTGG + Intergenic
963991281 3:151657981-151658003 GTGTGTATGTGTTTGTGTGTGGG + Intergenic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
964046273 3:152331183-152331205 GTGTGTATGTGTGTGTGTGTAGG - Intronic
964195684 3:154061915-154061937 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
964385941 3:156147936-156147958 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
964656301 3:159069877-159069899 GTGTGTGTGTGCGTGTGTATGGG + Intronic
964810884 3:160663524-160663546 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
964829049 3:160862651-160862673 GTGTGTGTGTGCGTGTGCCTAGG - Intronic
965002086 3:162967291-162967313 GTGTGAGTGTGTATGTATCTAGG - Intergenic
965176746 3:165344785-165344807 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
965264508 3:166523585-166523607 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
965382729 3:168010680-168010702 TTGTGGGTGTGCATGTGTATAGG - Intronic
965439262 3:168692350-168692372 GTGCACACGTGCATGTGTGTGGG + Intergenic
965775045 3:172220284-172220306 GTGTGCATGTGTTTGTGTGTTGG + Intronic
965894773 3:173562213-173562235 GTGTGCATGCATGTGTGTCTTGG + Intronic
966078094 3:175963533-175963555 ATGTGCATGTGTATGTATATAGG + Intergenic
966107300 3:176351730-176351752 GTGTGCATGTGTGTGTATGTGGG - Intergenic
966305396 3:178527767-178527789 GTGTGTGTGTGCATGATTCTAGG - Intronic
966608807 3:181848027-181848049 GTGTACATGTGCATTTTTCTGGG + Intergenic
966633305 3:182103418-182103440 AAGTGCATGTGCATTTGTGTTGG + Intergenic
966656948 3:182369795-182369817 TTGTGTGTGTGCATGTGTATAGG + Intergenic
966684685 3:182681287-182681309 GTGTGTATGTGTGTGTGTTTGGG - Intergenic
967241255 3:187441689-187441711 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
967503023 3:190222305-190222327 GTGTGCATGTGCGTGTGTGTCGG + Intergenic
967644854 3:191910181-191910203 GTGTGTATGTGTGTGTGTTTTGG - Intergenic
967935347 3:194723289-194723311 GTGCACATGTGCATGTGATTTGG + Intergenic
967987995 3:195109867-195109889 GTGTATGTGTGCATGTGTGTGGG + Intronic
968005785 3:195241787-195241809 GTGCGCATGTGTGTGTGTGTTGG - Intronic
968126641 3:196164985-196165007 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
968215744 3:196888691-196888713 GTGTGCATATGCATTTGTATAGG + Intronic
968231063 3:197004868-197004890 GGGTGGATGTGCATTTTTCTGGG - Intronic
968552151 4:1229292-1229314 GTGTGCGGGTGGATGTGTTTGGG - Intronic
968620005 4:1599785-1599807 GAGTGCCTGTGCAGGTGTCTGGG - Intergenic
968703654 4:2068335-2068357 GTGTACATGTGTTTGTGTCTTGG + Exonic
968731785 4:2272520-2272542 GTGTGCATGTGTGTGGGTGTGGG + Intronic
968891018 4:3368553-3368575 GGGTGCATGTGTGTGTGTGTGGG + Intronic
968933279 4:3595724-3595746 CTGTGCATGTTCATTTGTCATGG + Intergenic
968933808 4:3599055-3599077 GTGTGCATGTGAATGTGGGCAGG + Intergenic
968933856 4:3599689-3599711 GTGCACATGTGTATGTGTGTGGG + Intergenic
968935746 4:3609382-3609404 GTGTGCATGTGTCTGTGTGTTGG - Intergenic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969224085 4:5783084-5783106 GTGTGCGTGTGTGTGTGTGTAGG + Intronic
969361228 4:6665232-6665254 GTGTGCATGTGCATACATGTGGG - Intergenic
969514610 4:7639440-7639462 GTGTGTGAGTGCATGTGTGTGGG + Intronic
969514632 4:7639561-7639583 GGGTGCATGTGAATGTGTGTGGG + Intronic
969514668 4:7639997-7640019 GTGTGAAAGTGCATGTCTGTGGG + Intronic
969689337 4:8695628-8695650 GTGTGCATGTGCACAGGTATAGG - Intergenic
969698039 4:8746458-8746480 GTATGCATGTGTATGTGCATTGG - Intergenic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
969916599 4:10497815-10497837 GTGTGCCTTTGCATGTGCCAGGG - Intronic
970214973 4:13749391-13749413 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
970425325 4:15940577-15940599 GTATGTGTGTGAATGTGTCTAGG - Intergenic
970652437 4:18193505-18193527 TTGTGCATGTGTGTGTGTATTGG - Intergenic
971026854 4:22597708-22597730 GTGTGCATGTGTGTGTGTTATGG + Intergenic
971097235 4:23421280-23421302 GTGTGTGTGTGGATGTGTGTGGG + Intergenic
971108357 4:23552802-23552824 GTGTGTGTGTGAATGTGTTTAGG - Intergenic
971293126 4:25362928-25362950 GGGAGAATGTGCATGTGTCGGGG - Intronic
972019790 4:34297633-34297655 TTGTGTATGTGTATGTGTGTGGG + Intergenic
972099977 4:35403043-35403065 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
972268596 4:37486774-37486796 GTGTGCATGTGTATGTTTTGGGG - Intronic
972291797 4:37696591-37696613 GTGTGTGTATGCATGTGCCTCGG - Intergenic
972343076 4:38169599-38169621 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
972406767 4:38753510-38753532 GTGTGCATGTGTATGTATATTGG - Intergenic
972799126 4:42454662-42454684 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
972905395 4:43740180-43740202 GTGTACATGTGTATGTGTACAGG - Intergenic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973052913 4:45616659-45616681 GTGTGCATGTATGTGTGTGTGGG + Intergenic
973166396 4:47083336-47083358 GTGTGCATGCACATGTGTAATGG - Intronic
973583942 4:52372535-52372557 GAGAGTATGTGCATGTGTGTGGG - Intergenic
973884215 4:55304479-55304501 ATGTGCATGTGCAGGTTTTTGGG - Intergenic
974549955 4:63358932-63358954 GTGTGCACGTGTGTGTGACTGGG - Intergenic
974653537 4:64786849-64786871 GTGTGGGTGTGCATGTCTGTCGG + Intergenic
974913698 4:68153601-68153623 GTGTGTGTGTCCATGTGTATGGG + Intergenic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
975665618 4:76732248-76732270 GTATGTGTGTGCATGTGTGTTGG + Intronic
975870232 4:78772050-78772072 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
975892323 4:79044510-79044532 GTGTGCATGAGCCTTTATCTGGG + Intergenic
976019473 4:80603417-80603439 GTGTGCATGTATATATGTGTAGG - Intronic
976073657 4:81272227-81272249 GTGTGTGTGTGCCTGTGTGTAGG - Intergenic
976281610 4:83332386-83332408 GTGTGCTTGTCGATGCGTCTGGG + Intronic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
976829354 4:89296663-89296685 GTGTGCATATGTATGTGTGTGGG + Intronic
976924153 4:90476040-90476062 GTGTGTATGTGTGTGTGTGTGGG + Intronic
977286541 4:95114641-95114663 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
977564048 4:98563551-98563573 GTGTGCATGTGTATGTGTAGGGG - Intronic
978431633 4:108639402-108639424 GTGTGCACGTGCATTTTTCTAGG + Intergenic
978828107 4:113048913-113048935 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
979070759 4:116203691-116203713 GTGTGTGTGTGTATGTGTTTAGG - Intergenic
979237535 4:118419408-118419430 GCATGCATGTGCATGTGTGTTGG - Intergenic
979324039 4:119358168-119358190 GTGTGTATGTGCATGTATGAAGG + Intergenic
979604298 4:122621201-122621223 GTGTGCATGTGCTAATGTGTGGG + Intergenic
979882576 4:125980256-125980278 CTACGCATGTGCATGTGTGTGGG + Intergenic
980066350 4:128193371-128193393 GTGTGTATGTGTTTGTGTGTGGG - Intronic
980267306 4:130534158-130534180 GTGTGCATGTGCATATTTGTTGG - Intergenic
981222092 4:142248664-142248686 GTGTGTATGTGTATGTGTTTAGG + Intronic
981362455 4:143863169-143863191 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
981373182 4:143983931-143983953 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
981382281 4:144087207-144087229 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
981582702 4:146266398-146266420 ATGTGCATGGGCATGTGTGGTGG - Intronic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
982173465 4:152683431-152683453 GTGTGCCTGTGGGTGTGTGTTGG - Intergenic
982418220 4:155162276-155162298 GTGTGCACGTGTGTGTGTCCTGG + Intergenic
982435219 4:155377019-155377041 GTGTGCATGTGCTGTTGCCTAGG + Intergenic
982780512 4:159486237-159486259 GTGTATATGTACATGTGTATGGG - Intergenic
982840079 4:160173456-160173478 GTGTGTTTGTGTATGTGTGTTGG + Intergenic
982925256 4:161329088-161329110 GTGTATATGTGCATGTGTTCTGG - Intergenic
982926527 4:161343852-161343874 GTGTGCATGTTTGTGTGTGTTGG + Intergenic
983166501 4:164483666-164483688 GTGTGTGTGTGTCTGTGTCTGGG - Intergenic
983241877 4:165242854-165242876 GTGTGTATGTGCATGTATGAAGG + Intronic
983380551 4:166986820-166986842 GTGTGCATGTGTGTGTGTTGTGG - Intronic
983410873 4:167396278-167396300 GTGTGTATGTGTATGTGTAGTGG + Intergenic
983884316 4:172963320-172963342 GTATGCATGTGGATGTGTGTGGG - Intronic
984587831 4:181583005-181583027 GTGTGCATGCACATGTGTGTGGG - Intergenic
984699370 4:182808568-182808590 GTGTGCGTGTGCATATGTGTGGG + Intergenic
984699385 4:182808930-182808952 GTGTGCATGTGCGTGTGTGCAGG + Intergenic
984790621 4:183611565-183611587 GTGGGCATGTGCATGTGGTGTGG + Intergenic
985066675 4:186128884-186128906 GTGTGTATGTGTGTGTGTCTGGG + Intronic
985624705 5:979159-979181 GTGTGTGTGTGCATGGGTGTGGG - Intergenic
985637731 5:1047510-1047532 GTGTGAATGTGGGTGTGTGTCGG + Intergenic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985833784 5:2256074-2256096 CTCTGTATGTGCATGTGTGTGGG + Intergenic
985963588 5:3322376-3322398 CTCTGCATGTGTATGTGTGTGGG + Intergenic
986042044 5:4003028-4003050 GTGTGCATGTGCATGTTCTGTGG - Intergenic
986042094 5:4003694-4003716 GTGTGCAGGTGCATGTGTGCAGG - Intergenic
986049974 5:4080929-4080951 GTGTGCATGTGCACCTGTGTGGG - Intergenic
986153648 5:5151714-5151736 GTGTGTGTGTGTATGTGTGTGGG + Intronic
986205422 5:5620539-5620561 GTGTGCCTGTTTCTGTGTCTTGG - Intergenic
986359361 5:6961093-6961115 GTGTGTTTGTGCATGCGTTTGGG - Intergenic
986798963 5:11240139-11240161 GTGTGAATGTGTGTGTGTGTTGG - Intronic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
987468635 5:18303298-18303320 GTGTGTGTGTGTATGTGTGTGGG - Intergenic
987719837 5:21619098-21619120 GTGTGTATGTGTGTGTGTTTTGG + Intergenic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
988083392 5:26441815-26441837 GTGTGTATGTGTATCTGTGTGGG - Intergenic
988100080 5:26664111-26664133 ATGTGCATGTGAATGTGAGTTGG - Intergenic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988223996 5:28388040-28388062 GTGTGCTTGTGCATGTATGACGG + Intergenic
988700723 5:33671889-33671911 GTGAGTATGTGGATGTGTGTGGG - Intronic
988722235 5:33890683-33890705 GTGTGCGTGTGCATGCGTGTGGG + Intronic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
988976751 5:36523719-36523741 GTGTGCATGTGTATGTGTGTTGG + Intergenic
988988132 5:36640974-36640996 GTGTGTATGTGTGTGTGTGTTGG - Intronic
989074863 5:37553578-37553600 GTGTGCTTGTGCATGTGCTGAGG + Intronic
989078415 5:37589239-37589261 GTGTGTGTGTGTATGTGTGTAGG - Intronic
989205447 5:38805006-38805028 GTGTGCACGTGCATATGTATGGG - Intergenic
989268192 5:39501995-39502017 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
989323585 5:40165116-40165138 GGGTGCCTGTGGATGTGTTTGGG - Intergenic
989712955 5:44423275-44423297 GTGTGTATGTGGGTGTGTTTTGG - Intergenic
990197469 5:53334659-53334681 GTGAACTTGTGCATGTGTGTGGG - Intergenic
990365065 5:55062199-55062221 GTGTGCATATGCATGTGTGCAGG - Intergenic
990553529 5:56908573-56908595 GTGTGCGTGTGCATGCATCTGGG + Intergenic
990632488 5:57685509-57685531 GTGTGCATGTGCATGTGCATAGG + Intergenic
990846285 5:60143645-60143667 GTGTGTATGTGTGTGTGTTTTGG + Intronic
990970851 5:61504241-61504263 GAGTGCATGTGTGTGTGTCCAGG - Intronic
991113396 5:62926840-62926862 GTGTGCACGCGCGTGTGTGTTGG + Intergenic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991513693 5:67410286-67410308 GTGTGCATGTGTATTGGTCAGGG + Intergenic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
991957868 5:72013967-72013989 GTGTGCATGTGTATGTGCATGGG + Intergenic
992054930 5:72979342-72979364 GGGTGTATGTGTATGTGTCCAGG + Intronic
992083104 5:73253746-73253768 GTGTTCACGTGTATGTGTGTTGG - Intergenic
992357231 5:75998656-75998678 GTGTGAATGTGTATGTGTGTGGG + Intergenic
992389503 5:76317440-76317462 GTGTGTATGTGTGTGTGTGTTGG - Intronic
992536901 5:77715556-77715578 GTGTGCATGTGTGTGTGTCAGGG - Intronic
992723009 5:79578995-79579017 GTGTGTATTTGCATGTGTAGAGG + Intergenic
992746290 5:79824332-79824354 GTGTGCGTGTGTGTGTGACTAGG + Intergenic
993140061 5:84020618-84020640 GTGTGTATGTGTGTGTGTGTCGG - Intronic
993161793 5:84300901-84300923 GTGTGCATGTATATTTGGCTTGG - Intronic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
994146696 5:96403034-96403056 ATGTGCAGGTGCATGTGTGGAGG + Intronic
994291981 5:98037965-98037987 GTGTGTGTGTGCGTGTGTGTAGG - Intergenic
994587958 5:101735123-101735145 GTGTGCACGTGTGTGTGTTTGGG - Intergenic
994839907 5:104910239-104910261 GTGTGCATGTGCATGTGTTACGG - Intergenic
994939198 5:106299056-106299078 GTGTGCACGTGTATGTGACTGGG - Intergenic
994997773 5:107086370-107086392 GTGTGCGTGTGTGTGTGTGTGGG - Intergenic
995114951 5:108469129-108469151 GTGTGCCTGTGTGTGTGTGTAGG - Intergenic
995204664 5:109465948-109465970 GTGTGTCTGTGTGTGTGTCTTGG + Intergenic
995232257 5:109780538-109780560 GTGTGTGTGTGTATGTGTGTAGG + Intronic
995747012 5:115414832-115414854 GTTTACATGTGCGTGTGTGTGGG + Intergenic
995747016 5:115414856-115414878 GTGTGCATGTGTGTGTGTGTGGG + Intergenic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996384612 5:122898061-122898083 GTGTGCATGTATGTGTGTCGGGG + Intronic
996595508 5:125197712-125197734 GTGTGCATGTGTGTGTGTGAAGG + Intergenic
996747204 5:126855287-126855309 GTGTGCGTGTGCACATGGCTTGG - Intergenic
996904450 5:128582267-128582289 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
996916108 5:128713963-128713985 GTGTGTGTGTGCATGAGTGTTGG - Intronic
997085836 5:130797454-130797476 GTGTGTATGTGTATGTGTATTGG - Intergenic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997328330 5:133040761-133040783 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
997628841 5:135350952-135350974 ATGTGCCTGTGCGTGGGTCTCGG - Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998200638 5:140115168-140115190 GTATGCATGTGTGTGTGTGTGGG - Exonic
998365537 5:141628378-141628400 ATGTGTATGTGCATTTTTCTGGG - Intronic
998388346 5:141771351-141771373 GTGTGCATGTGTGTGTCTCCTGG + Intergenic
998682022 5:144478915-144478937 ATGTGTATGTGTATGTGTATGGG + Exonic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999030891 5:148289933-148289955 GTGTATATGTGTATGTGTGTTGG - Intergenic
999270940 5:150296064-150296086 GTGTGCATGTGTGTGTGTTGGGG - Intergenic
999319693 5:150606054-150606076 GTGTGCACATGTACGTGTCTGGG - Intronic
999414706 5:151384966-151384988 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
999668860 5:153940813-153940835 GTGTGCATGTGCATGTGGGTGGG - Intergenic
999734661 5:154503896-154503918 GTGTACGTGTGCATGTGTGTTGG + Intergenic
999742978 5:154570831-154570853 GTGTGTATGTGTGTGTGTTTTGG - Intergenic
999911000 5:156199060-156199082 GTGTGTATCTACATGTGTTTAGG - Intronic
1000039849 5:157477494-157477516 CTGTGCGTTTGTATGTGTCTGGG - Exonic
1000312689 5:160060706-160060728 GTATGCATGTGCATATATTTAGG + Intronic
1000679886 5:164170440-164170462 GTGTGCATATGCATGTGTGTTGG + Intergenic
1000756118 5:165162184-165162206 GTGTATATGTGTGTGTGTCTGGG - Intergenic
1000799232 5:165703862-165703884 GTGTGTGTGTGTATGTGTGTTGG + Intergenic
1000934180 5:167288155-167288177 TTTTGCATGTGTATGTGCCTGGG + Intronic
1001040619 5:168332523-168332545 GTGTGCACATGCATGTGTGCTGG + Intronic
1001185795 5:169570512-169570534 GTGTGCGTGTGTGTGTGTGTGGG + Intergenic
1001238122 5:170046753-170046775 GTGTGTATGTGTGTGTGTCTTGG - Intronic
1001428843 5:171643888-171643910 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001716718 5:173822498-173822520 GTGTGGGTGTGTATGTGTGTGGG + Intergenic
1001745860 5:174091669-174091691 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1001756098 5:174171423-174171445 CTGTCCATCTGCATGTGTGTGGG + Intronic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1002100986 5:176857489-176857511 GTGTGTGTGTGCGTGTGTGTAGG - Intronic
1002132486 5:177090138-177090160 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1002376668 5:178794074-178794096 GTGTGTGTGTGCATATGTATGGG - Intergenic
1002451125 5:179319063-179319085 GAGTGCACATGCATGTGTGTGGG - Intronic
1002466065 5:179409361-179409383 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1002737973 5:181411376-181411398 GCATGCATGTGCATGTGTGTTGG - Intergenic
1002881527 6:1256783-1256805 GTATGCATGTGTGTGTGTCTTGG - Intergenic
1002923117 6:1587235-1587257 GTGTGCATGAGGGTGTGTGTTGG + Intergenic
1002971408 6:2025483-2025505 GTGCGTGTGTGCATGTGTATTGG - Intronic
1003036728 6:2646499-2646521 GAGTGGATGTGCATGTGTAGTGG + Intergenic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003725812 6:8762173-8762195 GTGTTTAGCTGCATGTGTCTTGG + Intergenic
1003790072 6:9536324-9536346 GTGTGCATGTGTATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004118757 6:12798035-12798057 GTGTGTGTGTGTGTGTGTCTAGG - Intronic
1004127043 6:12883903-12883925 GTGTGTGTGTGCATGTGAGTGGG - Intronic
1004194473 6:13490695-13490717 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1004212142 6:13659241-13659263 GTGTGTATGTGTGTGTGTGTGGG - Intronic
1004395920 6:15246252-15246274 GTGTGTGTGTGTATGTGTTTCGG + Intergenic
1004481149 6:16020409-16020431 AAGTGCATGTGTGTGTGTCTAGG - Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1004883061 6:20027734-20027756 GTGTGTGTGTGTATGTGTATAGG - Intergenic
1005227146 6:23656187-23656209 GTGTGCATGTGCATATAGGTAGG - Intergenic
1005250134 6:23935974-23935996 TTCTGCAGGTGCATGTGCCTTGG - Intergenic
1005282108 6:24285037-24285059 GTGTGCATGTATGTGTGTGTGGG - Intronic
1005584048 6:27259145-27259167 GTGTGCATATGTGTGTGTGTTGG + Intergenic
1005735862 6:28745380-28745402 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1006237018 6:32642550-32642572 GTGCTCATGTGCATGTGTGTGGG - Intronic
1006247003 6:32746180-32746202 GTGCTCATGTGCATGTGTGTGGG - Intronic
1006464641 6:34185340-34185362 TTGTGCATGTGTATGTGTGTGGG - Intergenic
1006811998 6:36826152-36826174 GTGTGCATGCGCATGTGTTATGG + Intronic
1007231466 6:40350444-40350466 GTGGGCGTGTGTGTGTGTCTGGG - Intergenic
1007242470 6:40437000-40437022 GTGTGTGTGTGTATGTGTATGGG + Intronic
1007362847 6:41371267-41371289 GTGTGTATGTGTGTGTGTGTGGG - Intergenic
1007696704 6:43738614-43738636 GTGTGCCTGTGCGTGTGTGTGGG + Intergenic
1007829295 6:44626368-44626390 GTGTGCATGTGGGTGGGTGTGGG + Intergenic
1007832435 6:44648746-44648768 GTGTGCATGTGCATGTGTAAAGG - Intergenic
1007834572 6:44664674-44664696 GTATGCATGTGTGTGTGTGTGGG - Intergenic
1007941035 6:45781912-45781934 GTGTGCATGTGTGTGTCTGTAGG - Intergenic
1008128826 6:47697645-47697667 GTGTGCATATGTATATGTTTTGG + Intronic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008754295 6:54775879-54775901 GTGTATGTGTGCATGTGTGTTGG - Intergenic
1009297188 6:61966493-61966515 ATTTGCATGTGCATTTTTCTGGG + Intronic
1009515331 6:64609126-64609148 GGGAGCCTGTGCATGTGTGTAGG + Intronic
1009837481 6:69021883-69021905 GTGTGCATGTACATTTTTATAGG + Intronic
1009878163 6:69532297-69532319 GTGTTCATGTGTATGTGTCTTGG + Intergenic
1009997189 6:70909117-70909139 GTGTGAATGTGTGTGTGTTTGGG - Intronic
1010106450 6:72174968-72174990 GTGTGAATGTGTATGTGGGTGGG - Intronic
1010430825 6:75776672-75776694 GTGTGTGTGTGTATGTGTTTTGG + Intronic
1010691219 6:78912981-78913003 GTGTGTATGTGTGTGTGTCATGG + Intronic
1010830306 6:80519542-80519564 GTGTGCATATGTGTGTGTTTTGG + Intergenic
1010899922 6:81414408-81414430 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1010972400 6:82276829-82276851 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1011156780 6:84341834-84341856 GTGTGTGTGTGTATGTGTCCTGG + Intergenic
1011311822 6:85988188-85988210 GTATGCATGTGCATGGCTATAGG + Intergenic
1011379489 6:86727211-86727233 GTATGTATGTGCATGTATTTAGG + Intergenic
1011534970 6:88366910-88366932 GTGTGAGTGTGTATGTGTGTGGG + Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012095738 6:94956972-94956994 GGGTGCATATGAATGTGTTTAGG - Intergenic
1012130021 6:95478848-95478870 GTGTGCATGTGTATGTTGATGGG - Intergenic
1012340312 6:98113478-98113500 GTGTGTGTGTGCGTGTGTGTGGG - Intergenic
1012359408 6:98358737-98358759 GTGTGTATGTGTGTGTGTGTGGG + Intergenic
1012414103 6:98993953-98993975 GTGTGTATGTGCATATGTGCTGG - Intergenic
1012708199 6:102561754-102561776 GTGTGCATGTGCTTGTGTGTGGG + Intergenic
1012747636 6:103114682-103114704 GTGTGCATATGCAAGTGTGTGGG + Intergenic
1012950157 6:105509726-105509748 GTGTGCATGTGTGTGTGTGTGGG + Intergenic
1013233660 6:108177513-108177535 TTGTGCGTGTGCATGTGCCCAGG - Intronic
1013420852 6:109965446-109965468 GTGTGGATGTTCATATGTTTTGG - Intergenic
1013535671 6:111061053-111061075 GCGTGCATGTGCATGTGGGGAGG - Intergenic
1013811145 6:114045962-114045984 GTGTGCATGTGTGTGTTTATGGG - Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014107723 6:117585752-117585774 TTGTGCATGTGTATGGGTATGGG - Intronic
1014219403 6:118785199-118785221 GTGTGTGTGTGCGTGTGTGTTGG + Intergenic
1014227137 6:118861668-118861690 GTGTGCATCTGGCTGGGTCTGGG + Intronic
1014322253 6:119944598-119944620 GTGTGTGTGTGTATGTGTATAGG - Intergenic
1014519260 6:122420041-122420063 GTGTGCATGTGTGTGTGTTTGGG + Intronic
1014602797 6:123435976-123435998 GTGTGCATGTGTGTTTGGCTTGG - Intronic
1014643552 6:123944952-123944974 GTCTGTGTGTGCATGTGTGTTGG - Intronic
1014725628 6:124968345-124968367 GTGTGCGTGCGTGTGTGTCTGGG + Intronic
1015114033 6:129626656-129626678 GTGTGTATGTGTGTGTGTTTTGG - Intronic
1015526309 6:134177492-134177514 GTGTGCAGGTTGATGTTTCTGGG - Intronic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1015609164 6:134996802-134996824 GTTTGCATATGCATGGGTCTTGG - Exonic
1015901253 6:138070145-138070167 GTGTGCGTGTGTGTGTGTGTAGG + Intergenic
1016557351 6:145353506-145353528 TTGTGCATGTGAATGTGTGTGGG - Intergenic
1016772314 6:147865240-147865262 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1016862467 6:148734612-148734634 GTGTACATGTGTGTGTGTGTTGG - Intergenic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017277433 6:152585910-152585932 GTGTATGTGTGCATGTGTTTGGG + Intronic
1017665960 6:156720308-156720330 GTGTCTGTGTGCATGTGTGTGGG - Intergenic
1018165346 6:161088991-161089013 GTGTGCATGTGTGTGTGTATTGG - Intronic
1018300433 6:162396737-162396759 GTGTGCATGTGCATATGGGAGGG - Intronic
1018463553 6:164021812-164021834 GTGTGCATGTGTGTTTGTGTGGG - Intergenic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1018732265 6:166660322-166660344 GTGTGCATGTGTGTGTGTGCGGG + Intronic
1018788180 6:167125085-167125107 GTGTGTGTATGTATGTGTCTAGG - Intronic
1018837373 6:167495415-167495437 GTGTGTATAAGCATGTGTGTAGG - Intergenic
1019127869 6:169852879-169852901 ATGTGCATGTGCACGTGTGTGGG + Intergenic
1019243074 6:170686935-170686957 GCATGCATGTGCATGTGTGTTGG - Intergenic
1019377123 7:698800-698822 GTGTGCATGTGTGTGCATCTGGG + Intronic
1019553915 7:1619308-1619330 GTGTGTAGGTGTATGTGTGTCGG + Intergenic
1019922871 7:4173995-4174017 GTTTTCATGTGCATGTGTGTGGG - Intronic
1020017129 7:4837660-4837682 GTGTGTGGGTGCATGTGTGTTGG - Intronic
1020114677 7:5469886-5469908 GTGTGCGAGGGCATGTGTGTGGG + Intronic
1020159037 7:5754154-5754176 GTGTGTGTGCGCATTTGTCTGGG + Intronic
1021027066 7:15683047-15683069 GTGTCCATGTGCATTTGTGGAGG + Intronic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021577149 7:22115180-22115202 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1021607402 7:22422190-22422212 GTGTGCACATGTATGTGCCTGGG + Intronic
1021896405 7:25240085-25240107 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1022045171 7:26617019-26617041 GTGTGTGTGTGCGTGTGTGTAGG + Intergenic
1022096798 7:27146257-27146279 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1022846175 7:34212282-34212304 GTGTGCATGTGGAAGTGTGGAGG - Intergenic
1023068799 7:36406634-36406656 GTGTGTATGTGCAGGTGGATGGG + Intronic
1023096316 7:36663231-36663253 GGGAGCCTGTGCATGTGTCGGGG - Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023217173 7:37875397-37875419 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1023244714 7:38189123-38189145 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1023442845 7:40202475-40202497 GTCTGCATGTCTATGTGTTTCGG + Intronic
1023454968 7:40328765-40328787 GTGTGTATGTGTATGTGTTTTGG + Intronic
1023810700 7:43909193-43909215 GTGTGTTTGTGTATGTGTGTAGG - Intronic
1023862103 7:44222877-44222899 GTGTGCTCATGCATGTGTGTGGG + Intronic
1024088283 7:45915115-45915137 GTGCGCCTGTGCATGCGTGTGGG + Intronic
1024131291 7:46355126-46355148 GTGTATGTGTGCATGTGTGTAGG - Intergenic
1024155975 7:46625887-46625909 GTGTGTATGTGTGTGTGTTTTGG - Intergenic
1024193662 7:47037701-47037723 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1024866702 7:53911548-53911570 GTGTGTGTGTGCATGTGGATGGG - Intergenic
1024970781 7:55068112-55068134 GTGTGTGTGTGCATGTGTGGTGG + Intronic
1024987025 7:55203286-55203308 GTGTATATGTGTATGTGTGTGGG - Intronic
1026014554 7:66662791-66662813 GTGTGCAGGTGTATGTGTGTAGG + Intronic
1026204414 7:68244132-68244154 GTGTGTATGTGCAGGTGCATGGG - Intergenic
1026260459 7:68750695-68750717 GTGTGTGTGTGCATATGTGTGGG + Intergenic
1026331030 7:69352756-69352778 GTGTGCATGTGTGTATGTCTAGG - Intergenic
1026401012 7:70012938-70012960 GTGTGCATGTATGTGTGTTTTGG + Intronic
1026437175 7:70409497-70409519 GTGGGCTTGTACATGTGTGTAGG + Intronic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026962698 7:74418459-74418481 GTGTGCCCATGCATGTGTGTGGG - Intergenic
1026975648 7:74496288-74496310 ATGTGGGTGTGCATGTGTGTGGG + Intronic
1026975683 7:74496568-74496590 GTGTGGGTGTGCATGTGTGTGGG + Intronic
1026975689 7:74496594-74496616 GTGTGGGTGTGCATGTATGTGGG + Intronic
1027385146 7:77652608-77652630 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1027537241 7:79418820-79418842 GTGTGTGTGTGTATGTGTATTGG - Intronic
1027587576 7:80077036-80077058 GTGTGTATGTGTGTGTGTGTCGG + Intergenic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1027790069 7:82628358-82628380 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1028169963 7:87584280-87584302 ATATTCATGTGCATGTTTCTGGG + Intronic
1028224153 7:88230711-88230733 GTGTGCGTGTGTGTGTGTTTTGG - Intergenic
1028237297 7:88377991-88378013 GTGTGTCTGTGTATGTGTTTGGG - Intergenic
1028704283 7:93820005-93820027 GTGTGCATGTGTGTGTGTGTTGG + Intronic
1028755996 7:94434931-94434953 GTGGGTATGTGCATTTTTCTTGG + Intergenic
1028938871 7:96496976-96496998 GTGCGCATGTGTGTGTGTATAGG - Intronic
1029147355 7:98455983-98456005 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1029156666 7:98522090-98522112 GTGTGCATGTGCCTGTGTGAGGG + Intergenic
1029809432 7:103033066-103033088 GTGTGTATGTGTGTGTGTATGGG - Intronic
1029842500 7:103380998-103381020 GTGTGTGTATGCATGTGTGTGGG - Intronic
1029878171 7:103776028-103776050 GTGTGCATGTGCATGCATCCCGG + Intronic
1030371648 7:108706804-108706826 GTGTGTGTGTGTATGTGTGTAGG + Intergenic
1030399950 7:109036677-109036699 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1030909516 7:115229271-115229293 GTGTGCATGTGTATGGATGTGGG + Intergenic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031366920 7:120912613-120912635 GTGTGTATGTGTGTGTGTGTTGG - Intergenic
1031775227 7:125900647-125900669 GTGTGTATGTGTGTGTGTCAAGG - Intergenic
1032034221 7:128509725-128509747 ATGTGCGTGTGTGTGTGTCTAGG + Intergenic
1032479413 7:132234618-132234640 GTGTGTGTGTGTATGTGTATTGG + Intronic
1032501780 7:132405096-132405118 GTATGCATGTGTGTGTGTGTTGG + Intronic
1032525479 7:132576295-132576317 GTGTGCGTGTGCGTGTGCCGCGG + Intronic
1032854913 7:135825959-135825981 GTGTGCATGTGTGTGTGTTGGGG + Intergenic
1033190729 7:139276498-139276520 GTGTGCATATGGATCTGTCCTGG - Intronic
1033638050 7:143230835-143230857 GTGTGAATGTGAGTGTGTGTTGG - Intergenic
1033638052 7:143230887-143230909 GTGTGAATGTGAGTGTGTGTTGG - Intergenic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033638074 7:143231235-143231257 GTGTGAATGTGAGTGTGTGTTGG - Intergenic
1033660140 7:143397232-143397254 GTGTGCGTGTGTGTGTGTGTTGG - Intronic
1033765611 7:144486949-144486971 GTGCGCATGTGTATGTGTCTTGG - Intronic
1033820088 7:145124866-145124888 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
1033845110 7:145422258-145422280 GTGTGCGTGTGTGTGTGTGTTGG + Intergenic
1034423249 7:151000033-151000055 GTGTGAGTGTGGATGTGTGTAGG + Intronic
1034480058 7:151312905-151312927 GTGTGAGTGTGGATGTGTGTGGG + Intergenic
1034480152 7:151313671-151313693 GTGTGTGAGTGCATGTGTATGGG + Intergenic
1034612461 7:152384046-152384068 GTGTGTGTGTGCGTGTGTGTAGG + Intronic
1034799783 7:154048328-154048350 GTGTGTATGTGTGTGTGTCCTGG + Intronic
1034858246 7:154574188-154574210 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1034889421 7:154827195-154827217 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1034895502 7:154873749-154873771 ATGTGCGTGTGCCTGTGTGTGGG - Intronic
1034897068 7:154883026-154883048 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897087 7:154883409-154883431 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897114 7:154884067-154884089 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034897118 7:154884125-154884147 GTGTGTGTGAGCATGTGTATGGG - Intronic
1034937154 7:155207664-155207686 GTGTGGGAGTGCATGTGTGTGGG + Intergenic
1035048704 7:155985761-155985783 GTGTGCATGTGCATGCATGCAGG + Intergenic
1035094763 7:156344863-156344885 GTGTGTATGTGAGTGTGACTGGG - Intergenic
1035112911 7:156498208-156498230 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1035161433 7:156953090-156953112 GTGTGCATGTGATTCTGTGTAGG + Intronic
1035243126 7:157545063-157545085 GTGTGCATGGGTGTGTGTGTGGG + Intronic
1035288307 7:157820448-157820470 GTGTTTGTGTGCATGTGTGTGGG - Intronic
1035360762 7:158312724-158312746 GTGTGCAGGTGTGTGTGTGTGGG - Intronic
1035494646 7:159313345-159313367 GTGTTCAAGAGCATGTGTCAGGG - Intergenic
1035505048 8:121228-121250 GCATGCATGTGCATGTGTGTTGG + Intergenic
1035526833 8:320142-320164 GTGTCCAGGTGTGTGTGTCTAGG + Intergenic
1035526836 8:320170-320192 GTGTCCAGGTGTGTGTGTCTAGG + Intergenic
1035526848 8:320282-320304 GTGTCCAGGTGTGTGTGTCTAGG + Intergenic
1035526851 8:320310-320332 GTGTCCAGGTGTGTGTGTCTAGG + Intergenic
1035526858 8:320380-320402 GTGTCCAGGTGTGTGTGTCTAGG + Intergenic
1035526861 8:320408-320430 GTGTCCAGGTGTGTGTGTCTAGG + Intergenic
1035657497 8:1320993-1321015 GTGTGCCTCTGCGTGTGTGTGGG + Intergenic
1035664055 8:1367094-1367116 GTGGTCATGTGCATGTGTGTTGG - Intergenic
1035664169 8:1368373-1368395 GTGCATATGTGCATGTGTGTGGG + Intergenic
1035776613 8:2192077-2192099 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1035877378 8:3206226-3206248 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1036127580 8:6077257-6077279 GTGTGCACGTGTGTGTGTCTGGG + Intergenic
1036157512 8:6356492-6356514 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1036208890 8:6826086-6826108 ATGTGCATGTGCGTGTATATGGG + Intronic
1036590816 8:10166533-10166555 GTGTGCATGTGCATTTGTATGGG + Intronic
1036609056 8:10334198-10334220 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1036664042 8:10727329-10727351 GTGTGTGCATGCATGTGTCTGGG - Intronic
1036808762 8:11853078-11853100 GTGTGCACGTGGAGGTGTGTGGG - Intronic
1036973956 8:13388400-13388422 GTGTGGTTTTGCTTGTGTCTGGG - Intronic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037422005 8:18712536-18712558 GTGTATGTGTGTATGTGTCTAGG - Intronic
1037464061 8:19141597-19141619 GTGTGCGTGTACGTGTGTGTGGG - Intergenic
1037716669 8:21406853-21406875 GTGTGTATATGCATGTGTGTGGG + Intergenic
1037731830 8:21532514-21532536 GTGTGCATGTGCATGCATGTAGG - Intergenic
1037806481 8:22060434-22060456 GTGTGCGTGCGCATGTGTGAGGG - Intronic
1037855859 8:22370178-22370200 ATGTGCGTGTGCGTGTGTGTAGG + Intronic
1038023091 8:23566483-23566505 GTGTGTGCGTGCGTGTGTCTGGG - Intronic
1038553139 8:28486939-28486961 GCGTGTATGTGCATTTTTCTAGG - Intronic
1038648737 8:29383159-29383181 GTGGGGGTGTGCATGTGTGTGGG + Intergenic
1039129287 8:34243462-34243484 GTGTGCATGTGTATGTATTTTGG + Intergenic
1039131826 8:34273568-34273590 GTTTGCATGTGAGTGTGTGTTGG + Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039442396 8:37604278-37604300 ATGTGCGTGTGCATGTGTGTGGG - Intergenic
1039674484 8:39646525-39646547 GTGTGTATGTGTATTTGTGTTGG + Intronic
1039736116 8:40334890-40334912 GTGTGTGTGTGCATATGTATGGG + Intergenic
1039902219 8:41761334-41761356 ATGTGCATGTGTATGTGTGCAGG - Intronic
1039911082 8:41827766-41827788 GTGGGCGTGAGCATGTGTGTGGG - Intronic
1039911084 8:41827784-41827806 GCGTGAGTGTGCATGTGTGTGGG - Intronic
1039911091 8:41827871-41827893 GTGGGCGTGAGCATGTGTGTGGG - Intronic
1039955941 8:42207310-42207332 GTTTGCATTTGCATGTGATTGGG - Intronic
1040465134 8:47688035-47688057 GTGTGTGTGTGCATGCGTATAGG + Intronic
1040668876 8:49662771-49662793 GTATGCCTGTGTGTGTGTCTTGG + Intergenic
1040791672 8:51237693-51237715 GTGTGCGTGTGTGTGTGTTTGGG - Intergenic
1041106584 8:54450086-54450108 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1041430839 8:57778874-57778896 TTGTGCATGTGCATGTGTTTTGG - Intergenic
1041551837 8:59111587-59111609 ATGGGTATGTGCATGTGTATGGG - Intronic
1042099036 8:65254013-65254035 GTGTATGTGTGCATGTGTGTTGG + Intergenic
1042192067 8:66197119-66197141 GTATTCATATGCATGTGTATTGG - Intergenic
1042414209 8:68500625-68500647 GTGTGAGTGTGGATGTGTGTGGG - Intronic
1042642237 8:70949588-70949610 GTGTGTATGTGTGTGTGTGTTGG + Intergenic
1042803953 8:72751785-72751807 GTGTACATGTGCATGTAGGTGGG - Intronic
1042882777 8:73512641-73512663 GTGTGTGTGTGTATGTGTGTGGG + Intronic
1043143845 8:76625648-76625670 TTGTGCGTGTGTGTGTGTCTGGG - Intergenic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1043920393 8:85976192-85976214 GAGTGCATGTGCATGTATTCTGG - Intergenic
1044069068 8:87733541-87733563 GTGTGTGTGTGCATGTGTGCAGG - Intergenic
1044469721 8:92552529-92552551 GTGTACATGTGTGTGTGTGTGGG - Intergenic
1044584092 8:93852941-93852963 GTGTGCAGGAGGATGTGTATAGG - Intergenic
1044626368 8:94237883-94237905 GTGTGTATGTGTATGTGTTGAGG - Intergenic
1044776833 8:95698757-95698779 GTGTGCTTGTGTGTGTGTTTGGG - Intergenic
1044881702 8:96729863-96729885 GTGTGTATGGGCATGTGACATGG + Intronic
1044884891 8:96766541-96766563 GTGGCCCTGTGCATGTGTCAGGG + Intronic
1044893447 8:96862304-96862326 GTGTGTGTGTGTGTGTGTCTGGG + Intronic
1044922790 8:97183444-97183466 GTGTGTGTGTGTGTGTGTCTAGG - Intergenic
1045281119 8:100750516-100750538 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1045292931 8:100849261-100849283 GTGTGCATGTACAATTTTCTGGG - Intergenic
1045402838 8:101835728-101835750 GTGTGAGTGTGCATGTGGCCAGG + Intronic
1045658599 8:104412422-104412444 ATGTCTATGTGCGTGTGTCTTGG + Intronic
1045839651 8:106564400-106564422 GTGTGTGTGTGTATGTGTCCAGG - Intronic
1045885218 8:107087913-107087935 GTGTGAAAGTTTATGTGTCTTGG + Intergenic
1046283087 8:112059245-112059267 GTGTACATGTGCATGTGCCATGG + Intergenic
1046505164 8:115127549-115127571 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
1046547949 8:115675188-115675210 GTATACATGGGCATGTGTCTGGG + Intronic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1046869098 8:119184930-119184952 GTGTGCATGTGTGTGTGCATTGG + Intronic
1047122155 8:121916824-121916846 GTGTGCATGTGTATTTGTGTTGG + Intergenic
1047191367 8:122681818-122681840 GTGTGCATGTGTGTGCGTGTGGG + Intergenic
1047463738 8:125092539-125092561 GTGTACATGTGCATGTGATAGGG + Intronic
1047667007 8:127102827-127102849 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1047694603 8:127391086-127391108 GTGTGCATGGGAGTGTGTCAGGG + Intergenic
1047879045 8:129172255-129172277 GTGTGAGTGTGTATGTGTTTGGG + Intergenic
1047930828 8:129726989-129727011 GTGTGTGTGTGTATGTGTATTGG - Intergenic
1048047210 8:130784119-130784141 GTGTGTATGTGTGTGTGTGTTGG + Intronic
1048058616 8:130893832-130893854 GTGTGCATGTTTGTGTGTTTTGG + Intronic
1048162971 8:132037935-132037957 GTGTGCATGGGCATGTGTGGGGG - Intronic
1048287623 8:133154082-133154104 GAGTGAGTGTGCATGTGTGTAGG - Intergenic
1048307924 8:133296684-133296706 GTGTGTGTGTGTCTGTGTCTGGG - Intronic
1048379179 8:133849220-133849242 GTGTGCATGCGCATGTGTGGTGG + Intergenic
1048379749 8:133854972-133854994 GTGCACATGTGCATGTGTGGTGG + Intergenic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1048552245 8:135444401-135444423 GCATGCATGTGCATGTGTGATGG + Intergenic
1048736570 8:137508590-137508612 GTGTGCGTGTGTGTGTGTGTTGG - Intergenic
1048856585 8:138691291-138691313 GTGTGCACGTGCGTGTGTGCAGG + Intronic
1048856600 8:138691573-138691595 GTGTGCGTGTGCATTTGTGAAGG + Intronic
1048880763 8:138870875-138870897 GTGTGCATGTGCTTCTATCTAGG + Intronic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049172490 8:141170373-141170395 GTGTGTATATGAATGTGTGTGGG + Intronic
1049398589 8:142413362-142413384 GTGTGCGTGTGAGTGTGTGTGGG - Intergenic
1049398593 8:142413428-142413450 GTGTGCGTGTGAGTGTGTGTGGG - Intergenic
1049398597 8:142413494-142413516 GTGTGCGTGTGAGTGTGTGTGGG - Intergenic
1049410039 8:142469783-142469805 GTGTGCACGTGCGTGTGCGTGGG + Intronic
1049420998 8:142516614-142516636 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1049424038 8:142529838-142529860 GTGTGAGTGTGCATCTGTGTGGG + Intronic
1049520762 8:143088983-143089005 GTGTCCATTTGCATGTGTCCTGG - Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049525558 8:143124831-143124853 GTGTGCATGTACATATGTGAGGG - Intergenic
1049525572 8:143124998-143125020 GTGTGCATGTACATTTGTGAGGG - Intergenic
1049535995 8:143182588-143182610 GTGTGCATGTGAGTGTGTCTGGG + Intergenic
1049584011 8:143424684-143424706 GGGTCCACATGCATGTGTCTGGG + Intronic
1050072183 9:1826949-1826971 GCGTGCATGTGTGTGTGTGTTGG - Intergenic
1050275846 9:3998968-3998990 GTATGCATGTGCTTATGTCTTGG - Intronic
1050663024 9:7904435-7904457 GTGTCTATGTGTATGTGTTTAGG - Intergenic
1050786570 9:9411047-9411069 GTGTGTATGTGTGTGTGTGTTGG + Intronic
1051372305 9:16369006-16369028 GTGAGCATGTGCATTTATGTGGG + Intergenic
1052602621 9:30655354-30655376 GTGTGTGTGTGTGTGTGTCTTGG - Intergenic
1052745403 9:32435406-32435428 GTGGGTATGTGCATTTTTCTGGG - Intronic
1053172967 9:35904205-35904227 GTGTGTATGTGTATGTGTGAGGG + Intergenic
1053397754 9:37789778-37789800 GTGTGTGTGTGCCTGTGTCATGG + Intronic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054454437 9:65422496-65422518 GTGTGCATGTGTCTGTGTGTTGG + Intergenic
1054456279 9:65432057-65432079 GTGTCTGTGTGCATGTGTGTGGG - Intergenic
1054456301 9:65432304-65432326 GTGCACATGTGTATGTGTGTGGG - Intergenic
1054456856 9:65436085-65436107 CTGTGCATGTTCATTTGTCATGG - Intergenic
1054726024 9:68651020-68651042 ATGTGCATGTGAATCTGTCGGGG + Intergenic
1055002432 9:71467245-71467267 GTGTCCGTGTGTATATGTCTGGG - Intergenic
1055118264 9:72628489-72628511 GTGTGCACTTGCATGTGTGTGGG + Intronic
1055185977 9:73454672-73454694 GTGTGTATGTGTATGTTTCAGGG + Intergenic
1055253090 9:74332184-74332206 GTGTGTGTGTGCATATGTATAGG + Intergenic
1055289900 9:74771408-74771430 GTGTGTGTGCGCATGTGTGTAGG - Intronic
1055295029 9:74825479-74825501 GTGTGTATGTGTGTGTGTATAGG + Intronic
1055381998 9:75717522-75717544 GTGTGCATGTGTATGTGTCGAGG - Intergenic
1055488099 9:76776883-76776905 GTGTGTGTGTGTATGTGTTTTGG - Intronic
1055555230 9:77467021-77467043 GTGTGTGTGTGTGTGTGTCTTGG + Intronic
1055580287 9:77701480-77701502 GTGTGTGTGTGTATGTGTGTGGG + Intergenic
1056460343 9:86803749-86803771 GTGTGCATATGCATGTGTGTTGG + Intergenic
1056674474 9:88662913-88662935 GTGTGCATGGGCCTATTTCTGGG - Intergenic
1056687324 9:88777392-88777414 GTGTGTGTGTGCATGTGTACGGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1056797488 9:89668867-89668889 GCATGCCTGTGCATGTGCCTGGG + Intergenic
1056804355 9:89717337-89717359 GTGTCTATGTGTATGTGACTAGG - Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057035025 9:91805712-91805734 GTGTGCATATGTGTGTGTGTGGG - Intronic
1057381614 9:94572318-94572340 GTGTGCGTGTGTGTGTGTCGTGG - Intronic
1057480119 9:95438462-95438484 CTATGCATGTGGATGTGTTTGGG + Intergenic
1057579128 9:96270237-96270259 GTGTGTGTGTGTATGTGTTTGGG - Intronic
1057850564 9:98564088-98564110 GTGTGCATGTGTGGGTGTGTGGG + Intronic
1057975767 9:99604380-99604402 GTTAGAATGTGCATGTGTTTGGG - Intergenic
1058420192 9:104826192-104826214 GTGGGTATGCGCATGTGTGTGGG - Intronic
1058609819 9:106763342-106763364 GTGTGTGTGTGTATGTGTGTTGG - Intergenic
1058622603 9:106899220-106899242 GTGTGTATGTGTGTGTGTGTGGG + Intronic
1058744931 9:107981273-107981295 GTGTGCATTTGCACGTGTGTGGG + Intergenic
1058758386 9:108104963-108104985 GTGTGCATGTACGTGTGCTTGGG + Intergenic
1059253114 9:112904976-112904998 GTGTGTATGTGTGTGTGTGTAGG + Intergenic
1059413299 9:114147721-114147743 GTGTGCGTGTGTGTGTGTATGGG - Intergenic
1059553759 9:115257233-115257255 GTGTGTCTGTGCATGTTTGTGGG - Intronic
1059601839 9:115787140-115787162 GTGTGCATCTGAATGTTTATGGG - Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060252810 9:121999735-121999757 GTGTGCACGCGCACGTGTGTGGG - Intronic
1060492964 9:124098414-124098436 GTGTGTTTGAGCACGTGTCTGGG + Intergenic
1060554081 9:124499437-124499459 ATGGTCATGTGCATGTGTGTGGG - Intronic
1060613284 9:124988060-124988082 GTATGTGTGTGCATGTGTGTAGG - Intronic
1060759762 9:126237305-126237327 GTGTGCATGTGCATGCATTTGGG + Intergenic
1060942204 9:127549321-127549343 GTGTGAGTGTGCATGCGTGTGGG - Intronic
1060942210 9:127549470-127549492 GTGTGAGTGTACATGTGTGTGGG - Intronic
1061005187 9:127924901-127924923 GTGTGTGCGTGCATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061245516 9:129399505-129399527 GTGTGCATGTGCATGTCTGTGGG - Intergenic
1061416217 9:130448299-130448321 GTGTGCATGCACACGTGTGTGGG - Intronic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062021310 9:134320697-134320719 GTGTGCGTGTGTGTGTGTGTTGG + Intronic
1062049821 9:134441593-134441615 GTGTGCATGGGAGTGTGTATGGG - Intergenic
1062104519 9:134746234-134746256 GTGTGCATGTGGTTCTGTCCAGG - Intronic
1062106911 9:134760301-134760323 GTGTGCATGTGTGTATGTGTGGG - Intronic
1062106951 9:134760575-134760597 GTGTGCATGTGTCTGAGTGTGGG - Intronic
1062197996 9:135285244-135285266 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198009 9:135285307-135285329 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198022 9:135285370-135285392 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198045 9:135285493-135285515 GTGTGCACATGCCTGTGTGTTGG - Intergenic
1062198057 9:135285556-135285578 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198110 9:135285867-135285889 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198147 9:135286056-135286078 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198160 9:135286119-135286141 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198173 9:135286182-135286204 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062198227 9:135286552-135286574 GTGTGCACATGCCTGTGTGTGGG - Intergenic
1062205975 9:135337594-135337616 GGGTATATGTGCATGTGTGTGGG + Intergenic
1062237674 9:135519791-135519813 ATGTGGGTGTGCATGTGTATGGG + Intergenic
1062298462 9:135848500-135848522 GTGTGTGTGTGTGTGTGTCTGGG - Intronic
1062316151 9:135967948-135967970 GTGTGCATGTTCATGTGTGCGGG + Intergenic
1062378446 9:136275441-136275463 GTGTGCACGTGTGTGTGTGTGGG - Intergenic
1203603263 Un_KI270748v1:36159-36181 GCATGCATGTGCATGTGTGTTGG - Intergenic
1203611112 Un_KI270749v1:5420-5442 GTGTGTGTGTGCATTGGTCTAGG + Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1185764376 X:2713372-2713394 TTGTGTATGTGCATATGTGTAGG - Intronic
1185833857 X:3327295-3327317 GTGAGTATGTGTATGTGTGTTGG - Intronic
1185863857 X:3605008-3605030 GTGTGTGTGTGTGTGTGTCTTGG - Exonic
1185939326 X:4297714-4297736 GCATGCATGTGCATGTATGTAGG - Intergenic
1186084483 X:5972191-5972213 GTTTGTGTGTGCATGTGTGTGGG + Intronic
1186269580 X:7871235-7871257 GTGTGTATTTCCATGTGTTTAGG + Intergenic
1186293579 X:8124901-8124923 GTGAGCATGTGGATGAATCTGGG - Intergenic
1187694805 X:21908643-21908665 GTGTGCATGTGTATGGGACGAGG - Intergenic
1188319200 X:28714539-28714561 ATGTGCATGAGTTTGTGTCTTGG - Intronic
1188550181 X:31355648-31355670 GTGTGCATGTGTCTGTGTTGGGG + Intronic
1188668045 X:32848995-32849017 GTGTGTATGTGCATGTGCTGGGG + Intronic
1189211369 X:39286813-39286835 GTGTGCATGTGCCTATGTAGAGG - Intergenic
1189296897 X:39924979-39925001 GTGTGTGTGTGTATGTGTATGGG - Intergenic
1189309551 X:40009857-40009879 GTGTGCCTGTGTGTGTGTGTTGG - Intergenic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1189363856 X:40373313-40373335 GTGTGTATGTGCGTGTATATAGG + Intergenic
1189631256 X:42956099-42956121 ATGTGTGTGTGTATGTGTCTTGG + Intergenic
1189895786 X:45654723-45654745 TTGGGCAGGTGTATGTGTCTGGG + Intergenic
1190108992 X:47577849-47577871 GTGTGCCAGTGCGTGTGTGTGGG + Intronic
1190440704 X:50471697-50471719 GTGTGTGTGTGTGTGTGTCTTGG + Intergenic
1191957949 X:66666791-66666813 GTGTGTGTGTGCATGTGTAGGGG + Intergenic
1192185502 X:68944253-68944275 GTGTGCATGTGTCTGTGTGTGGG + Intergenic
1192298750 X:69878711-69878733 GTGTGTGTGTGTGTGTGTCTTGG - Intronic
1192538430 X:71948363-71948385 GTGAGCATGTGCAAGTGGTTTGG + Intergenic
1192664705 X:73077718-73077740 GTGTGTGTGTGTGTGTGTCTTGG - Exonic
1192797986 X:74440415-74440437 GTGTGTATGTGTGTGTGTGTTGG + Intronic
1192826527 X:74702941-74702963 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1193959916 X:87912706-87912728 GTGTATATGTGTATGTGTGTGGG + Intergenic
1194620824 X:96169083-96169105 ATGTGCATGGGCATATGTGTGGG + Intergenic
1194689912 X:96971424-96971446 GTGTGTATGTGTGTGTGTGTGGG + Intronic
1194861675 X:99006247-99006269 GTTTGCATGTGCATGTGGAGAGG + Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1196070121 X:111511339-111511361 GTTTGCATGTGTATATTTCTAGG - Intergenic
1196193740 X:112819189-112819211 GTGTGCATGTGTGTGTGGCTGGG - Intronic
1196305374 X:114096208-114096230 GTGTGCATGTGCAGGGCTGTGGG - Intergenic
1196744347 X:119056159-119056181 GTGTGCATGCACATCTGCCTGGG + Intergenic
1196755067 X:119150668-119150690 GTGTGCGTGTGCGTGTGAGTGGG - Intergenic
1196819298 X:119690332-119690354 GTGTGTATGTGTATGTATGTGGG - Intronic
1198083731 X:133263658-133263680 GTGTGTGTGTGTATGTGTGTAGG - Intergenic
1198279373 X:135126722-135126744 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1198291584 X:135245792-135245814 GTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1198301970 X:135342494-135342516 GTGTGTATGTGCTTGTGTGGAGG + Exonic
1198681240 X:139184627-139184649 GTGTGTATGTGTGTGTGTGTAGG - Intronic
1198961450 X:142187727-142187749 GTGTTCATGTGTGTGTGTGTGGG - Intergenic
1198978591 X:142366839-142366861 GTATGCATGTGCATGTGAGCAGG + Intergenic
1199085373 X:143622639-143622661 GTATGCATGTGTATGTGTGTAGG + Intergenic
1199114040 X:143968985-143969007 GTGTGTGTGTGTGTGTGTCTAGG + Intergenic
1199531284 X:148850525-148850547 GTATGCATGTGTGTGTGTGTGGG - Intronic
1199868276 X:151873896-151873918 GTGTGCGTGTGCATGCATCTGGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1199943246 X:152644922-152644944 GTGAGCATGTGAATGTGTGTAGG - Intronic
1200012909 X:153133528-153133550 GTGTGGATGTGTGTGTGTTTGGG - Intergenic
1200026692 X:153266391-153266413 GTGTGGATGTGTGTGTGTTTGGG + Intergenic
1200065128 X:153500956-153500978 GTATGCATGTGTGAGTGTCTAGG + Intronic
1200785960 Y:7260609-7260631 GTGTGTGTGTGTGTGTGTCTGGG + Intergenic
1201052518 Y:9951709-9951731 GTATGTATGTGTATGTGTGTTGG + Intergenic
1201153902 Y:11112430-11112452 GGGTGCATGTGCATTTGTTTTGG + Intergenic
1201232395 Y:11877976-11877998 GTGTGTATGTGTTTGTGTATGGG + Intergenic
1201340243 Y:12925618-12925640 GTGTGCGTCTGCACGTGTCAGGG + Intergenic
1201450700 Y:14110417-14110439 GGGTGACTGTGCATGTGTCAGGG - Intergenic
1201617767 Y:15920692-15920714 GTGGGCATTTGAGTGTGTCTGGG - Intergenic
1201765676 Y:17571588-17571610 GTGTGCGTGTGCACGTGCATAGG - Intergenic
1201835876 Y:18334401-18334423 GTGTGCGTGTGCACGTGCATAGG + Intergenic
1201852607 Y:18503027-18503049 GTGTGCACGTGTGTGTGTGTGGG - Intergenic
1201880714 Y:18817357-18817379 GTGTGCACGTGTGTGTGTGTGGG + Intronic
1202385329 Y:24321211-24321233 GCATGCATGTGCATCTGTGTCGG - Intergenic
1202485457 Y:25348917-25348939 GCATGCATGTGCATCTGTGTCGG + Intergenic