ID: 981602154

View in Genome Browser
Species Human (GRCh38)
Location 4:146501891-146501913
Sequence CAGTAAACGTGATTGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981602154_981602157 6 Left 981602154 4:146501891-146501913 CCTGAATCCAATCACGTTTACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 981602157 4:146501920-146501942 CTACCATCCTGCTCTTCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 152
981602154_981602159 12 Left 981602154 4:146501891-146501913 CCTGAATCCAATCACGTTTACTG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 981602159 4:146501926-146501948 TCCTGCTCTTCAAAAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981602154 Original CRISPR CAGTAAACGTGATTGGATTC AGG (reversed) Intronic
902939314 1:19788466-19788488 CAGGGACCGGGATTGGATTCTGG + Intronic
907618664 1:55952811-55952833 CTGTCAACTTGATTGGATTGAGG + Intergenic
914244318 1:145874326-145874348 CACTAAACAAGATTGGCTTCTGG - Intronic
915437860 1:155922618-155922640 CAGTAAATGTGAATGAATTGAGG - Intronic
917340734 1:173974882-173974904 CAGTGAAGGTAAATGGATTCTGG + Intronic
1065150320 10:22816337-22816359 CGGTCAACGTGACGGGATTCAGG - Intergenic
1069321778 10:67180487-67180509 CAGTTACTGTGAGTGGATTCAGG + Exonic
1069934820 10:71907932-71907954 CAGGAAATTTGATTGGATCCTGG + Intergenic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1074095703 10:110310263-110310285 CAATAAACTTGATTGTATTCAGG - Intergenic
1078743977 11:14093533-14093555 CGGAAAACGTGATTGGCTCCTGG - Intronic
1087172615 11:95066304-95066326 AAGTAAATATGATTGGATTCAGG + Intergenic
1088151417 11:106749890-106749912 CAGTAAATATGATTGTATTAGGG + Intronic
1094657008 12:32429932-32429954 CAGTAAACCTGATAGGAATTTGG - Intronic
1097506874 12:60484492-60484514 GTGTCAACTTGATTGGATTCAGG - Intergenic
1100427977 12:94504993-94505015 AAGGAAACTGGATTGGATTCTGG + Intergenic
1100764374 12:97847176-97847198 CAGGAAATGTGAATGGTTTCTGG + Intergenic
1106106872 13:26740735-26740757 CAGTAGACTTGATTCCATTCTGG - Intergenic
1109694512 13:65935659-65935681 TGGTAAACTAGATTGGATTCTGG + Intergenic
1112710239 13:102119406-102119428 CAATAACCTTGATTGGATCCTGG + Intronic
1115731638 14:36275735-36275757 TAGTGAACCTGATTGGATTCAGG + Intergenic
1121988634 14:98532545-98532567 CAGTGAAAGTGATTGGACTCAGG - Intergenic
1130436666 15:83906547-83906569 CAGTAAATGTGGTTGAATTCTGG + Intronic
1130650830 15:85761212-85761234 GTGTCAACTTGATTGGATTCGGG + Intronic
1133662524 16:7933115-7933137 GTGTCAACGTGATTGGATTCAGG - Intergenic
1135137862 16:19898155-19898177 CAGTAAGCGGAATTGGAGTCGGG + Intergenic
1138831486 16:60380295-60380317 AAGAAAATGTGTTTGGATTCTGG + Intergenic
1141931104 16:87203464-87203486 CAATCAAGGTGGTTGGATTCAGG - Intronic
1143999405 17:11038769-11038791 CAATCAACGTGTTTGGATTGTGG + Intergenic
1145790661 17:27624716-27624738 GTGGAGACGTGATTGGATTCAGG + Exonic
1150252731 17:63717218-63717240 CAGTAAAGTTGATTTGATACTGG + Intronic
1156104919 18:33648315-33648337 GATGAAAAGTGATTGGATTCTGG + Intronic
1161473279 19:4472048-4472070 CAGTTAACGGGATTGGATAACGG - Intergenic
1164433818 19:28210801-28210823 CTTTAAAGGTGATTGGATTTGGG - Intergenic
925638914 2:5968838-5968860 CATGACACGTGATAGGATTCGGG - Intergenic
926024618 2:9530587-9530609 CAGAAAACTGGATTGGATCCTGG + Intronic
928479470 2:31667396-31667418 CTGTCAACTTGATTGGATTGAGG + Intergenic
932825688 2:74937468-74937490 CATGAAACGTGATTGGGTTCAGG + Intergenic
935271177 2:101435698-101435720 AACTAAACGGGATTGGAATCTGG + Intronic
935878312 2:107536109-107536131 CAGTCAATGGGATTGGGTTCTGG + Intergenic
936912333 2:117605828-117605850 CTGTAAGTGTGACTGGATTCAGG + Intergenic
938685573 2:133734468-133734490 CAGTAAAGTTGAGTGGATTTGGG + Intergenic
938685579 2:133734501-133734523 CAGTAAAGTTGAGTGGATTTGGG + Intergenic
943709809 2:191078982-191079004 CAGTAAATGTTATTGGAATTTGG - Intronic
945725545 2:213469110-213469132 CTGTCAACTTGATTGGATTGAGG - Intronic
1170358377 20:15517695-15517717 CAGTAAACGCTCCTGGATTCAGG - Intronic
1170853751 20:20028899-20028921 CAGTAAACGTTAATGGACTTAGG + Intronic
1179982713 21:44904998-44905020 CAGTAAATGTGTTTGGCTTTGGG + Intronic
1181963965 22:26643473-26643495 TAGTCATCGTGATTGGGTTCAGG + Intergenic
1182808181 22:33093497-33093519 CAGTAAACGTAAATGGACCCAGG + Intergenic
1185136509 22:49076386-49076408 GAGTTAACATAATTGGATTCTGG - Intergenic
949417289 3:3828523-3828545 CTGTCAACTTGATTGGATTGAGG - Intronic
954764097 3:52898136-52898158 AAATGAAAGTGATTGGATTCAGG - Intergenic
955180275 3:56661454-56661476 CAGTAAAGGGGATTTGATACTGG + Intronic
955734605 3:62024688-62024710 AAGTAAACATTATTGGATGCAGG + Intronic
955811449 3:62795029-62795051 CAGTAAACATGAGTGGCTTGTGG - Intronic
958036001 3:88171246-88171268 GAGTCAACTTGACTGGATTCAGG + Intergenic
958118247 3:89250557-89250579 AAGTAACCAAGATTGGATTCTGG - Intronic
958720816 3:97840932-97840954 AAGTAAACGTGAATTGATTTTGG - Intronic
959015649 3:101131107-101131129 CAGTAAACATCCTTGGATGCAGG + Intergenic
963583597 3:147156543-147156565 CAATAAAGATGATGGGATTCTGG + Intergenic
970890733 4:21041483-21041505 AAGTAAATGTGTTTGGATTATGG + Intronic
979398560 4:120219587-120219609 GTGTAAACTTGATTGGATTGAGG + Intergenic
979632983 4:122923858-122923880 AAGTTAACGTGATTCCATTCAGG + Intronic
980325947 4:131346375-131346397 AAGTAAAGGTAATTGGAATCAGG + Intergenic
981463104 4:145034158-145034180 AAGTCAACTTGATTGGATTGAGG + Intronic
981602154 4:146501891-146501913 CAGTAAACGTGATTGGATTCAGG - Intronic
981971507 4:150667767-150667789 CAGTCAGCATGGTTGGATTCTGG - Intronic
982591654 4:157321214-157321236 CAGTAAACGTGTATTGATTAGGG + Intronic
982687857 4:158513411-158513433 CAGTAAACATGATAGGAATGAGG + Intronic
983149074 4:164254923-164254945 CTGTCAACTTGATTGGATTTAGG - Intronic
984142461 4:176020479-176020501 GTGTAAACATGTTTGGATTCAGG - Intergenic
985179104 4:187237342-187237364 CAGAGAAAGTGATTTGATTCAGG - Intergenic
990255998 5:53969978-53970000 CTGTAAAGGTGATTGCATGCTGG + Intronic
991235135 5:64385052-64385074 CAGTCAACCTGCTTAGATTCAGG - Intergenic
991348189 5:65692676-65692698 CAAGAAATGTGGTTGGATTCTGG + Intronic
992746803 5:79828246-79828268 CAGTAAACATGATTGGGTTGGGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
1000385847 5:160674103-160674125 CAGTATTTGAGATTGGATTCAGG + Intronic
1002446223 5:179291620-179291642 CATTAAACGAGGTTGAATTCTGG + Intronic
1005302941 6:24488932-24488954 CTGTAAAAGTGCTTGGCTTCAGG - Intronic
1009641367 6:66341684-66341706 TATGAAACGTGATTGAATTCTGG + Intergenic
1009770076 6:68134469-68134491 CTGTCAACTTGATTGGATTGAGG - Intergenic
1011799273 6:90992496-90992518 TATTTAACGTGATTGGATGCTGG - Intergenic
1015682549 6:135824454-135824476 CAGTAAACCTGTTTGGTGTCTGG + Intergenic
1018535463 6:164814253-164814275 CTGTCAACTTGATTGGATTGAGG - Intergenic
1021090476 7:16477276-16477298 CAGTAAACAGGCTTGGCTTCTGG - Intronic
1021293129 7:18870236-18870258 CAGTATGCTGGATTGGATTCTGG - Intronic
1023669110 7:42557404-42557426 AAGTAAAACTGATTGGATTAGGG + Intergenic
1028254414 7:88576195-88576217 CAGTATCCTGGATTGGATTCTGG - Intergenic
1030416773 7:109253985-109254007 CTGTCAACTTGATTGGATTGAGG - Intergenic
1030484951 7:110153495-110153517 CAGAATACGTGAATGGATTCTGG + Intergenic
1030622199 7:111802166-111802188 CAGTAAGAGTGATTGAGTTCAGG - Intronic
1030737928 7:113071794-113071816 TATTAAAAATGATTGGATTCTGG - Intergenic
1031215952 7:118891543-118891565 CATTAAACATTATTGGCTTCAGG - Intergenic
1031324838 7:120382020-120382042 TAACAAATGTGATTGGATTCTGG - Intronic
1037692868 8:21197469-21197491 CATTAAAGATGATAGGATTCTGG + Intergenic
1039779322 8:40768465-40768487 CTTTAAACGTGATGGGAATCCGG - Intronic
1040594217 8:48822004-48822026 CAGTAAACGTGATGTGATCAGGG + Intergenic
1041964126 8:63654896-63654918 TAGTAACCTGGATTGGATTCTGG - Intergenic
1045401865 8:101827263-101827285 CAGGACACGTGATTGTATTTTGG + Intronic
1049827350 8:144678044-144678066 CAGTAAAGATGATTGGGTTTAGG - Intergenic
1050900595 9:10943266-10943288 CAGCAAAAATGATGGGATTCTGG + Intergenic
1058292762 9:103262891-103262913 GTGTCAACTTGATTGGATTCAGG + Intergenic
1061333834 9:129915918-129915940 CAGAAAACCTGATTAGACTCAGG + Intronic
1188310425 X:28610440-28610462 CAGTGAAGGTGAATGCATTCCGG + Intronic
1189131565 X:38503282-38503304 CAATCAACTTGATTGGGTTCAGG - Intronic
1192700079 X:73459446-73459468 AAGTATACGTGATTGTATTTAGG - Intergenic
1193024740 X:76833973-76833995 CTGTAAATGGGATTGCATTCTGG + Intergenic
1194742100 X:97585920-97585942 CAGTACACGTTATGGAATTCAGG - Intronic
1197585997 X:128349142-128349164 CTGCAAAAGTGTTTGGATTCTGG + Intergenic