ID: 981602179

View in Genome Browser
Species Human (GRCh38)
Location 4:146502413-146502435
Sequence CTACATCAGAAGCTATTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981602179 Original CRISPR CTACATCAGAAGCTATTTAT AGG Intronic
900346315 1:2212200-2212222 CTACATCAGAAGCTTGCTCTTGG - Intronic
901553901 1:10016657-10016679 GGAAATCAGAAGCTATCTATGGG + Intergenic
902352031 1:15863525-15863547 TTATATTAGAAACTATTTATTGG - Intronic
905781253 1:40711991-40712013 CTAAATCAGACACTATTTTTAGG - Intronic
906922485 1:50079272-50079294 CTACATCAGAATCTACTTCCTGG - Intronic
908887562 1:68807292-68807314 ATACCTAAGAAGTTATTTATAGG + Intergenic
909036779 1:70602367-70602389 TTACATCTGCTGCTATTTATAGG + Intergenic
909247631 1:73307866-73307888 CTAAGTCAGAAACTGTTTATAGG + Intergenic
909890521 1:81000515-81000537 CTCCAAGAGGAGCTATTTATCGG - Intergenic
910289362 1:85585238-85585260 CTGCATAAGAAGCAATTTGTTGG - Intergenic
911795697 1:102073018-102073040 ATAAATCAGAAGCTATTAAATGG + Intergenic
912297353 1:108483039-108483061 CTATATCAGAAGTTTATTATAGG - Intergenic
912735087 1:112143380-112143402 CTAAATCAGAATCTATTAATAGG - Intergenic
916437151 1:164787761-164787783 TGACATCAGAAGCTTTTTAAAGG + Intronic
917849637 1:179050002-179050024 CTACATCAAAAGCCCTTTAGTGG + Intronic
919186913 1:194162819-194162841 CAACATCAGCAGATATTTAAGGG + Intergenic
919369956 1:196710382-196710404 ATAGAATAGAAGCTATTTATAGG + Intronic
922045756 1:221944888-221944910 ATACATCAGAATCCTTTTATAGG - Intergenic
924483253 1:244455266-244455288 GGAAATCAGAAGCTATTCATGGG - Intronic
1068133031 10:52918948-52918970 CTTCAGGAGAAGCTATTGATAGG - Intergenic
1068753866 10:60628205-60628227 CTATGTCAGATGCCATTTATAGG + Intronic
1074555474 10:114485051-114485073 GCACATCAGAAGCTATCTTTTGG - Intronic
1075133509 10:119761742-119761764 CTGCTGCAGAAGCTATTAATTGG - Intronic
1075750247 10:124763152-124763174 TTACTTCAGAAGCAATTTAAGGG - Intronic
1075959290 10:126553974-126553996 CTACATCAGAGGGTAGGTATAGG - Intronic
1076122550 10:127947937-127947959 TCACATGAGAAGGTATTTATTGG - Intronic
1078945346 11:16060956-16060978 TTAAATCAGAAACTATTGATTGG - Intronic
1080028489 11:27636566-27636588 GGAAATCAGAAGCTATCTATGGG + Intergenic
1083118691 11:60490597-60490619 CGACATGAAAAGATATTTATAGG + Intergenic
1086275554 11:85124101-85124123 CACCATCAGCTGCTATTTATTGG + Intronic
1086852615 11:91827981-91828003 CTACATCAAGCTCTATTTATGGG + Intergenic
1090980904 11:131720988-131721010 CTAGATAAGAAGGTATTTCTAGG - Intronic
1092993791 12:13928425-13928447 CTAATTCAGAAGATATTTAAAGG + Intronic
1093099466 12:15010411-15010433 CTACATCAAAGGTTATTTTTAGG + Intergenic
1094665717 12:32518739-32518761 AAACATCATAAGCTATTTAATGG + Intronic
1099383673 12:81987514-81987536 CTGCAACAGAAGCACTTTATAGG + Intergenic
1100669951 12:96801348-96801370 CCACATTACAAGCTATTCATTGG + Intronic
1101112435 12:101499112-101499134 TTACATCATAAGGTGTTTATTGG - Intergenic
1106222649 13:27759510-27759532 CTGCATTAAAATCTATTTATGGG - Intergenic
1114438053 14:22724533-22724555 CTAAACTATAAGCTATTTATAGG + Intergenic
1118102238 14:62619704-62619726 GTAAAACTGAAGCTATTTATAGG - Intergenic
1121041297 14:90750892-90750914 CTCTGTCAGAAGCTATTTACAGG + Intronic
1125187039 15:36942918-36942940 CTAAATTAGAAGCTATTGAAAGG - Intronic
1128859849 15:71059195-71059217 CTAACTCAGAGGTTATTTATAGG + Intergenic
1133309231 16:4832339-4832361 CGACAGCAGAATCTATTTCTAGG - Intronic
1133791234 16:9010949-9010971 CTACAGCAGAAGGCAATTATTGG + Intergenic
1133878421 16:9757513-9757535 CTAAACCATAAGCTACTTATGGG + Intronic
1144503097 17:15806651-15806673 CTACATGAACAGCTATTTAAAGG + Intergenic
1144596152 17:16571779-16571801 CCATCTCAGAATCTATTTATAGG + Intergenic
1149118239 17:53126526-53126548 CTAAATCACCAGCTATTTATTGG - Intergenic
1149979432 17:61297991-61298013 CTTCATCAGTAGCTTTTTGTGGG + Intronic
1156675447 18:39522386-39522408 CTTCATCAGAAGGTATCTATGGG - Intergenic
1156717613 18:40030077-40030099 CTACATCTCAATTTATTTATTGG - Intergenic
1158025347 18:52890048-52890070 GGAAATCAGCAGCTATTTATTGG - Intronic
1167450418 19:49564974-49564996 CTACACCAGAAGTTATGTGTGGG + Intronic
1168091366 19:54087204-54087226 TTAAATCAGAAGCTATGCATTGG - Intergenic
925444620 2:3916855-3916877 CCAGATCCGAAGCTCTTTATAGG + Intergenic
926932488 2:18054408-18054430 TTAGATCAGAAGCTCTTTAAGGG - Intronic
927195142 2:20541758-20541780 CTGCTTCAGAAGCTACTTGTGGG - Intergenic
928818625 2:35331672-35331694 CTAATTCAGAGGCTATTTAAAGG + Intergenic
928841019 2:35604842-35604864 CTAGATTATAAGCTATTTAGAGG + Intergenic
931220702 2:60285838-60285860 CCACTTCAGAAGCTTTTTATGGG + Intergenic
931292541 2:60887721-60887743 CTACTGCAGAAGCTCTTAATTGG - Intronic
933408391 2:81892750-81892772 ATGCATTTGAAGCTATTTATAGG - Intergenic
935537878 2:104315420-104315442 CTACATCACAAGCTTATTTTAGG + Intergenic
939779802 2:146431803-146431825 CTACTACAGAAGATACTTATTGG - Intergenic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
945559914 2:211326962-211326984 TGACTGCAGAAGCTATTTATTGG + Intergenic
945617485 2:212090716-212090738 CCACTTCAGATGCTATTTAAAGG + Intronic
947284488 2:228497305-228497327 ATTCATTAGAAGCAATTTATAGG - Intergenic
948561000 2:238851836-238851858 CTACATCAGATCTTATTGATGGG - Intronic
1174370015 20:50080265-50080287 CTCCACTAGAAGCCATTTATTGG - Intergenic
1182053794 22:27333819-27333841 CTTCATGAGAGGCTATTTCTGGG - Intergenic
955198849 3:56831118-56831140 CTTCATCAGTAAATATTTATTGG - Intronic
956228125 3:66982675-66982697 CTCTATTAGAAGCTATTGATAGG + Intergenic
958604132 3:96336948-96336970 CTACATCTCAAGTTATTTCTGGG + Intergenic
962891338 3:139675803-139675825 CTACCTCAGAAGGTTATTATGGG - Intronic
964614917 3:158652898-158652920 GTACACCAGAAGCTATTAACTGG - Intronic
965045782 3:163574814-163574836 ATACATGAGAAGCAATTTTTTGG - Intergenic
965450379 3:168831380-168831402 GTATATCAGAAGTTAATTATAGG + Intergenic
965613961 3:170574107-170574129 CTACCTGAGAAGCTAGTTCTGGG + Intronic
967570162 3:191018839-191018861 CTACATCAGGAAGTATTTAGGGG - Intergenic
969089001 4:4678863-4678885 CTACCTGAGAAGCTATATCTGGG - Intergenic
969187596 4:5488853-5488875 CTAATTCAGAGGCTATTTAGAGG - Intronic
969881342 4:10176738-10176760 CTAGATCAGAAACTTTTAATTGG + Intergenic
970511317 4:16784550-16784572 CTGCCTCTGAAGCTATTTCTAGG - Intronic
971814145 4:31465458-31465480 AGAAATCAGAAGCTATTCATGGG + Intergenic
973225316 4:47777176-47777198 GTTAATCAGTAGCTATTTATTGG - Intronic
974387054 4:61215222-61215244 CTGCACCAGAACATATTTATGGG + Intronic
974667128 4:64977602-64977624 CTACCTCAGAAGTTATTTGGAGG - Intergenic
974778331 4:66517918-66517940 CTACAACAAAAGCTATTTTTAGG + Intergenic
975311823 4:72912200-72912222 ATACATCAGATGCTACTTGTGGG - Intergenic
977427727 4:96890333-96890355 CTATAACAGGAGCTCTTTATGGG + Intergenic
977551191 4:98445710-98445732 CTACATTACAAACTATTAATAGG - Intergenic
978638935 4:110845163-110845185 CTACATGAAAAGGTCTTTATAGG - Intergenic
981602179 4:146502413-146502435 CTACATCAGAAGCTATTTATAGG + Intronic
983188763 4:164731759-164731781 CTAAAACAGAGGCTTTTTATGGG + Intergenic
987443273 5:17984028-17984050 CTACAGCAGAATGTAGTTATAGG - Intergenic
989202189 5:38774856-38774878 CAATCTCAGAAGCTATTTACTGG - Intergenic
990723755 5:58730170-58730192 CTACATTAGAAACTATTTGTAGG + Intronic
993360832 5:86974042-86974064 CTAGATCAGGAGCTATGTAAGGG - Intergenic
993418840 5:87674262-87674284 CTATATCACAGGCTATTTCTAGG - Intergenic
993724286 5:91350554-91350576 CTATATCATAAGCTATTAATGGG + Intergenic
994657169 5:102608268-102608290 GTACAAAAGAAGGTATTTATAGG + Intergenic
995071645 5:107929660-107929682 ATACATCAGCAGATATTTCTTGG - Intronic
996156202 5:120105438-120105460 ATACATAAGAAACTATTTTTTGG - Intergenic
996949753 5:129111251-129111273 CAAAAACAGCAGCTATTTATGGG - Intronic
1003369595 6:5511206-5511228 GTACATGAGAAGGTATTTAAGGG + Intronic
1015098190 6:129442373-129442395 CTACAAGAGAAGCCATTTCTGGG - Intronic
1017688141 6:156934000-156934022 GGACAGCAGAAGCTTTTTATAGG + Intronic
1018410311 6:163538579-163538601 CGAGATGAGAAGCTATTTATTGG + Intronic
1021668388 7:23011553-23011575 ATAGATGAGAAGCCATTTATTGG - Intronic
1027678489 7:81189128-81189150 CTACATCACAAGATATCTTTAGG - Intronic
1030351973 7:108499822-108499844 CTACAAGATAAACTATTTATTGG + Intronic
1031026644 7:116686486-116686508 CTACATCATCAGCTTGTTATGGG + Intronic
1031396557 7:121281116-121281138 CCACATCAGAAGTTCTTTGTGGG + Intronic
1032600625 7:133290072-133290094 CTTCATAAGAAGCTTTTTAAAGG + Intronic
1035663006 8:1361342-1361364 CTACTTCAGATGCTATTTATAGG + Intergenic
1037790661 8:21937648-21937670 AATCATCAGAAGTTATTTATTGG + Intronic
1043174593 8:77008846-77008868 CTACATCTTAAACTATTTAGTGG + Intergenic
1043193309 8:77255269-77255291 CAACCACAGAAGTTATTTATAGG + Intergenic
1043982226 8:86656646-86656668 CTTCTTCAAAAGCTATCTATTGG - Intronic
1044308568 8:90666196-90666218 CTACACCACAATCTATATATAGG + Intronic
1045484942 8:102623540-102623562 CTCCATCAGAAGCTTCTTCTGGG - Intergenic
1046583942 8:116128261-116128283 AAACATTAGAGGCTATTTATTGG - Intergenic
1051370914 9:16358274-16358296 CTCCATCAGAAGCCATTGAGTGG - Intergenic
1051380990 9:16458265-16458287 ATATATCAAAAGTTATTTATTGG + Intronic
1052278406 9:26704789-26704811 GTAATACAGAAGCTATTTATAGG - Intergenic
1053729054 9:41033933-41033955 CTATAGCAGAAGCAATGTATGGG + Intergenic
1054699458 9:68398150-68398172 CTATAGCAGAAGCAATGTATGGG - Intronic
1057095999 9:92310302-92310324 CTTCGTCAGAAGCAATTTCTTGG - Intronic
1058644850 9:107121538-107121560 CTACTTCTGAAGGTATTTTTTGG - Intergenic
1060100998 9:120841133-120841155 GTACACCAGAAACTATTAATAGG - Intronic
1186097700 X:6119919-6119941 CTACATTTGGAGCTATTTTTTGG - Intronic
1186711526 X:12202880-12202902 CACCACCAGAAGCTATTAATGGG + Intronic
1186725375 X:12352530-12352552 TTTCATCAGAAACTATTGATAGG + Intronic
1186748483 X:12596011-12596033 CCAGATAAGAAGCAATTTATGGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189261086 X:39679272-39679294 CTATGTCTGAAGCTATTTGTTGG + Intergenic
1189460929 X:41242459-41242481 CTTCATCAGAAGTTAATTTTAGG + Intergenic
1191101154 X:56730020-56730042 CTTCAACAGATGCTTTTTATTGG - Intergenic
1191616949 X:63180080-63180102 CTACAACAGAGGCTATTTTGAGG - Intergenic
1191619348 X:63198843-63198865 CTACAACAGAGGCTATTTTGAGG + Intergenic
1192984882 X:76387021-76387043 CTAAATCAGAAGTTATCTAAAGG - Intergenic
1193885284 X:86976848-86976870 CTAAATCAAAAATTATTTATAGG - Intergenic
1194423979 X:93713940-93713962 CTACATCAGTACCTATATCTAGG + Intergenic
1197218168 X:123886558-123886580 ATACTTGGGAAGCTATTTATTGG - Intronic
1198657252 X:138927936-138927958 TTACATATAAAGCTATTTATCGG + Intronic
1198810598 X:140532182-140532204 CTACATAAAAAGGTACTTATTGG - Intergenic
1199151787 X:144495775-144495797 CAACAATTGAAGCTATTTATGGG + Intergenic
1199326006 X:146499136-146499158 ATACATGAGAAGCTATTCCTAGG + Intergenic