ID: 981603433

View in Genome Browser
Species Human (GRCh38)
Location 4:146518003-146518025
Sequence CTGGGTCACCACATATCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981603433_981603443 15 Left 981603433 4:146518003-146518025 CCTAGAGATATGTGGTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 981603443 4:146518041-146518063 GCCTTCCAGGAAATCCTCTCTGG No data
981603433_981603439 2 Left 981603433 4:146518003-146518025 CCTAGAGATATGTGGTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 981603439 4:146518028-146518050 AGGCCTGGTCCCTGCCTTCCAGG No data
981603433_981603446 22 Left 981603433 4:146518003-146518025 CCTAGAGATATGTGGTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 981603446 4:146518048-146518070 AGGAAATCCTCTCTGGAGTTAGG 0: 1
1: 1
2: 0
3: 18
4: 211
981603433_981603447 26 Left 981603433 4:146518003-146518025 CCTAGAGATATGTGGTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 981603447 4:146518052-146518074 AATCCTCTCTGGAGTTAGGATGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981603433 Original CRISPR CTGGGTCACCACATATCTCT AGG (reversed) Intronic
900660697 1:3781362-3781384 CTGGGTCACCTCTCATCTCCAGG - Intronic
903799707 1:25957562-25957584 CTGGAGCACCACTTATCCCTAGG - Intergenic
904003376 1:27350860-27350882 CTGGGTCGCAACATCTTTCTGGG + Exonic
904582829 1:31560083-31560105 CTATTTCACCACATATGTCTAGG + Intergenic
905331509 1:37203837-37203859 CTGGGTGTACAAATATCTCTTGG - Intergenic
907174760 1:52508743-52508765 CTGTGTAACCTCTTATCTCTAGG - Intronic
912021938 1:105116537-105116559 ATGGGGAACCACATATTTCTTGG - Intergenic
913430453 1:118785462-118785484 CTGCCACACCACAAATCTCTTGG - Intergenic
913448975 1:118979699-118979721 CAGGGTCCCCACATTTCTCCAGG + Intronic
914938280 1:151999850-151999872 CTGGGTCTCCACCTATCTTCTGG + Intergenic
915203468 1:154251506-154251528 CTGGCTCAGCAGATATCTCAGGG + Exonic
919058352 1:192599166-192599188 CTGTATCACCACAAAACTCTGGG - Intergenic
919554576 1:199034785-199034807 CTCGGTCACCAAATGTCTGTCGG + Intergenic
922372838 1:224929023-224929045 CTGGGTGACTTCATATTTCTTGG - Intronic
922619593 1:226981658-226981680 CTGGGTCCCTACATCCCTCTTGG + Intronic
1063280564 10:4625157-4625179 CCAAGTCACCACATTTCTCTGGG + Intergenic
1068714170 10:60169074-60169096 CTGGGTCAACTGATATTTCTGGG + Intronic
1070968587 10:80544938-80544960 CTGGGTCATCATTCATCTCTCGG + Intronic
1071840260 10:89463097-89463119 CTGGGTCCCCAGATGACTCTGGG + Intronic
1076071673 10:127495306-127495328 CTGAATCACCACATAGCTCATGG - Intergenic
1081695880 11:45108736-45108758 CTGGGTCCCCACATAGCTACAGG - Intronic
1083095341 11:60244757-60244779 CTGGGTAACCTCATCCCTCTGGG - Intergenic
1083098509 11:60278857-60278879 CTGGGTGACCTCATCCCTCTGGG + Intergenic
1088982895 11:114879626-114879648 CTTGGTCACAACCCATCTCTTGG - Intergenic
1092897076 12:13022333-13022355 CTGGGACTCCATATATCTCCTGG + Intergenic
1093229564 12:16527032-16527054 CTGTGGCACCACTTAGCTCTAGG + Intronic
1095606248 12:44071176-44071198 CTGGGTTTCCAAATAGCTCTGGG + Intronic
1096805468 12:54138481-54138503 CTTGATCACCAGGTATCTCTGGG - Intergenic
1101079927 12:101172160-101172182 CTGGGGCACCAAGTGTCTCTAGG + Intronic
1101377550 12:104184080-104184102 CTGGGTGACCTCATTCCTCTTGG - Intergenic
1101699459 12:107158424-107158446 GTGGGTCATGAAATATCTCTGGG + Intergenic
1106407474 13:29486489-29486511 CTGGGCTCCCACATTTCTCTGGG - Intronic
1107150503 13:37105476-37105498 CTGGGCCACCACCTCTTTCTCGG + Exonic
1111406520 13:87813736-87813758 TTGGGTCTCCCCATTTCTCTAGG - Intergenic
1115128467 14:30024740-30024762 GTGGGTCACTGCATATCTTTGGG + Intronic
1120145706 14:80976264-80976286 CTGGTTCTCCACATACCTTTGGG + Intronic
1120235779 14:81889157-81889179 ATGGGTCACCTCACATCTCTGGG + Intergenic
1127034298 15:54897921-54897943 GTGTGTCAGCACATATATCTAGG - Intergenic
1129414357 15:75366991-75367013 CTGGCTCAGCAAATATCTCCTGG - Intronic
1129853154 15:78806549-78806571 CTGAGTCACTGCATATCTCTGGG + Intronic
1132447206 15:101934976-101934998 CTGCATCACCTCAAATCTCTGGG - Intergenic
1133502372 16:6378319-6378341 CTGGGTCACCATCTCTCTGTTGG - Intronic
1134331204 16:13252531-13252553 CTGGCTCACCCCACATCTGTTGG + Intergenic
1143127454 17:4652576-4652598 CCCGGCCACCACACATCTCTTGG - Intergenic
1144076421 17:11723460-11723482 TTAGCTCACCACATATCTCCTGG - Intronic
1145980226 17:29006673-29006695 CTGGGTCCCCACGTAGCCCTGGG + Intronic
1147224054 17:38961876-38961898 CTGGAGCACTACAGATCTCTAGG - Exonic
1148091785 17:45026802-45026824 CAGGGAGACCACATATCTGTGGG + Intronic
1151180622 17:72325075-72325097 CTGGGTCAACACATACATTTGGG - Intergenic
1153532341 18:6060207-6060229 CTGGATAACCACATAGCTCAAGG - Intronic
1154263217 18:12856139-12856161 CTGGGTGACTTCATGTCTCTGGG - Intronic
1155247778 18:23926360-23926382 TTGGGTTTCAACATATCTCTTGG - Intronic
1155815586 18:30304554-30304576 CTGGGTCACCATTTATGTGTGGG - Intergenic
1157502325 18:48200300-48200322 GTGGGTCACTAAATATGTCTCGG - Intronic
1162171650 19:8794425-8794447 AAGGGTCACCACATATCCCAGGG - Intergenic
1163234266 19:16021930-16021952 CTGGGACACCACCAAGCTCTGGG - Intergenic
1163704574 19:18804709-18804731 CTGGGTCCCCACATCTCTCCGGG + Intergenic
931896910 2:66742601-66742623 CTAATTCACCAGATATCTCTTGG - Intergenic
939325351 2:140680713-140680735 CAGGCTTACCACATATCTCTAGG + Intronic
942763855 2:179430880-179430902 CTGGGGCACCAAATGCCTCTGGG + Intergenic
948787762 2:240361865-240361887 CTGGGCCTGCACACATCTCTGGG - Intergenic
1169490368 20:6066149-6066171 CTTGTTCACCACATTTCTTTAGG + Intergenic
1169726585 20:8740497-8740519 CTGAGTCACCATATATTTTTGGG + Intronic
1169826283 20:9772234-9772256 GAGGGTCACCACTAATCTCTTGG - Intronic
1172678115 20:36689685-36689707 CTGGGTCAGCACCTTTCCCTTGG + Intronic
1173598139 20:44273280-44273302 CTGGTTCGCCTCCTATCTCTTGG + Intronic
1174306601 20:49617837-49617859 CTGTGTCACCAAATGGCTCTTGG + Intergenic
1175528858 20:59660115-59660137 GTGAGGCCCCACATATCTCTGGG + Intronic
1176070442 20:63223455-63223477 CTGGGTCATCACTTGTCTGTAGG + Intergenic
1177184878 21:17782280-17782302 CTGGGTCCCCACATTTTTCTGGG + Intergenic
1184582799 22:45428819-45428841 CTGGGTCACCCCATAGGTCTGGG + Intronic
1184676702 22:46046898-46046920 CTGGGTAACCTCACCTCTCTGGG + Intergenic
960460251 3:117925415-117925437 CTGGGTCACCCCAGAAGTCTGGG + Intergenic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
969143720 4:5102076-5102098 CTGGTTCACTCCTTATCTCTGGG - Intronic
969893241 4:10279117-10279139 CAAGGTCAACACATATCTCTAGG + Intergenic
970226127 4:13858937-13858959 ATGGGTCATCAGAAATCTCTAGG + Intergenic
973600313 4:52536105-52536127 CTGGGTCCTCACATATTACTTGG + Intergenic
974199642 4:58622340-58622362 CTGCGTCCCCACATGTTTCTGGG - Intergenic
978073294 4:104497191-104497213 CTAGGTTACCTCATTTCTCTGGG - Intergenic
981603433 4:146518003-146518025 CTGGGTCACCACATATCTCTAGG - Intronic
984254977 4:177380903-177380925 GTGGGTCACCACATTCCCCTTGG - Intergenic
988364884 5:30284722-30284744 CAGGGTTACCAAATATTTCTTGG - Intergenic
991240850 5:64458575-64458597 CTGGGTCACCCCAATCCTCTGGG + Intergenic
993601974 5:89937436-89937458 CTGGGTTTCAACATATTTCTTGG + Intergenic
997473015 5:134127218-134127240 CAGGGGCACCTCATAGCTCTGGG + Intronic
999086616 5:148897698-148897720 CTGCTCCACCACATAGCTCTGGG - Intergenic
999152829 5:149437781-149437803 CTGGGGCGCCACACATTTCTTGG + Intergenic
1003747850 6:9023356-9023378 CTGGGTCACCAAATTTGTCTTGG + Intergenic
1004450610 6:15741934-15741956 TAGGGTCACCAAATATCTTTAGG - Intergenic
1006435973 6:34026466-34026488 CTGGGTGACCACAGACCCCTCGG + Intronic
1010690827 6:78909599-78909621 CTGGGTCCCCACATTTCACTAGG + Intronic
1012711112 6:102606726-102606748 CTGGCTCCCCACTTATCTCAGGG - Intergenic
1014269988 6:119325951-119325973 CTGAGGCACAAAATATCTCTTGG + Intronic
1019324125 7:429682-429704 CTGGGCCTCCACAGAGCTCTAGG - Intergenic
1021944570 7:25714194-25714216 CTGAGTCACCCCATAGCACTTGG + Intergenic
1023179176 7:37464164-37464186 CTGGGTCACCATACACCTCAAGG + Intergenic
1024085600 7:45889291-45889313 CTGGGTCTCTAAAGATCTCTGGG - Intronic
1032971592 7:137170495-137170517 CTTGTTCAACCCATATCTCTTGG - Intergenic
1034990075 7:155542603-155542625 CGGGGTCCCCACATATCCCGGGG + Intergenic
1038647334 8:29372834-29372856 CTGGGTAACCAACTGTCTCTGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1048051521 8:130821600-130821622 CTGGGTCACCTCATACCCTTGGG - Intronic
1050746203 9:8879130-8879152 CTGGGTCCCCAAGTATCTATAGG + Intronic
1054904566 9:70403337-70403359 CTGGGTCACATCCAATCTCTGGG - Intronic
1056513463 9:87328129-87328151 CTGAGAGACCACCTATCTCTGGG - Intergenic
1060872527 9:127054324-127054346 CTGGGTCCTCACATAGCTCCCGG - Intronic
1061179356 9:129014616-129014638 CTGAGTGACCTCCTATCTCTGGG - Intronic
1062447687 9:136602475-136602497 CTGGGGCACCACAAACATCTGGG + Intergenic
1188399825 X:29730832-29730854 CTGTGTCATCTCATATCTGTGGG - Intronic
1189149965 X:38696509-38696531 CTGTATTACCACACATCTCTTGG + Intergenic
1189752533 X:44237167-44237189 CTGAATCCCCCCATATCTCTGGG - Intronic
1190509046 X:51158261-51158283 CTGGGTTACCACATTTCCATAGG + Intergenic
1191680451 X:63834927-63834949 CTCCCTCACCACACATCTCTGGG - Intergenic
1195684246 X:107571153-107571175 CTGGGCCACAAGATATCCCTTGG - Intronic
1195921395 X:109987414-109987436 CTGGGTCCGCTCACATCTCTGGG - Intergenic
1197773990 X:130108609-130108631 CTGTGTCACCACTTAGCACTAGG + Intronic
1198130774 X:133692829-133692851 CTGGAGCACTACATATCTTTTGG + Intronic