ID: 981603806

View in Genome Browser
Species Human (GRCh38)
Location 4:146521809-146521831
Sequence CTGCATGTCTGGAGGGACCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981603806_981603812 18 Left 981603806 4:146521809-146521831 CCTTGGTCCCTCCAGACATGCAG 0: 1
1: 0
2: 0
3: 22
4: 318
Right 981603812 4:146521850-146521872 CGATTGTAAAGTAAAGACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 86
981603806_981603813 19 Left 981603806 4:146521809-146521831 CCTTGGTCCCTCCAGACATGCAG 0: 1
1: 0
2: 0
3: 22
4: 318
Right 981603813 4:146521851-146521873 GATTGTAAAGTAAAGACCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 164
981603806_981603811 17 Left 981603806 4:146521809-146521831 CCTTGGTCCCTCCAGACATGCAG 0: 1
1: 0
2: 0
3: 22
4: 318
Right 981603811 4:146521849-146521871 CCGATTGTAAAGTAAAGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 49
981603806_981603814 20 Left 981603806 4:146521809-146521831 CCTTGGTCCCTCCAGACATGCAG 0: 1
1: 0
2: 0
3: 22
4: 318
Right 981603814 4:146521852-146521874 ATTGTAAAGTAAAGACCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 164
981603806_981603815 29 Left 981603806 4:146521809-146521831 CCTTGGTCCCTCCAGACATGCAG 0: 1
1: 0
2: 0
3: 22
4: 318
Right 981603815 4:146521861-146521883 TAAAGACCTGGGGGTTGCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981603806 Original CRISPR CTGCATGTCTGGAGGGACCA AGG (reversed) Exonic
900325855 1:2108343-2108365 ATGCATGGCTGCAGGGACAAGGG - Intronic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900615090 1:3561938-3561960 CTGGATCTTTGGAGGAACCAAGG - Intronic
901573323 1:10179719-10179741 CTGGATGTCTGCAGGGAAAAAGG - Intronic
902933282 1:19746152-19746174 CCTCATGTTTGGAGGGAACATGG - Intronic
903697572 1:25219486-25219508 CTGAAAGTCTAGAGGGACCAAGG - Intergenic
904289342 1:29474058-29474080 CTGCAGGTCTAGAGGGTCCAGGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906117791 1:43367487-43367509 CGGCAGGCCAGGAGGGACCAAGG + Exonic
906152734 1:43597600-43597622 CAGCCTGCCTGGAGGGACCCTGG + Intronic
906507323 1:46389826-46389848 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
906709101 1:47916018-47916040 CTGCAGGTCTGCAAGGACCTGGG + Intronic
907037355 1:51228404-51228426 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
907326376 1:53641108-53641130 CTGAATATCTTGGGGGACCACGG + Intronic
907870429 1:58437987-58438009 CTGCACATATGGAGGGAACATGG - Intronic
910591010 1:88928149-88928171 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
912463936 1:109856377-109856399 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
912859077 1:113196958-113196980 CAGCATGTCCTCAGGGACCAAGG + Intergenic
913470487 1:119181056-119181078 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
916553795 1:165875559-165875581 TTGCATGTCTGCAGGGGGCAGGG - Intronic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
917560465 1:176147819-176147841 CTGCATTTCTGGAGAGATAATGG - Intronic
920176979 1:204108021-204108043 GTGCCTGGCTGGAGGGACCGTGG + Intronic
920567036 1:206982322-206982344 CTCCATGGCTAGAGTGACCAGGG + Intergenic
921037193 1:211392119-211392141 TTCCTTGTCTGAAGGGACCATGG - Intergenic
921092613 1:211857932-211857954 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
922339386 1:224643459-224643481 CGGCTTGTCTGGAGAGACCCTGG + Intronic
922684713 1:227630178-227630200 CTGCCTTTCTGGAGAGACTAAGG - Intronic
923123999 1:231019933-231019955 CTGCACGACAGGAGGGACCGAGG - Exonic
924944430 1:248837057-248837079 ATGCAGGTCTGGAGTGATCAGGG - Intergenic
1062786270 10:267837-267859 CAGCATGTGTGCAGGGACCACGG - Intergenic
1063465924 10:6244385-6244407 GGGAATTTCTGGAGGGACCATGG + Intergenic
1063501938 10:6563322-6563344 CTGCATGTCTGGAGGTGCGTGGG + Intronic
1070426326 10:76291504-76291526 ATGCATTTCTGGAAGGCCCAAGG + Intronic
1070485126 10:76922933-76922955 CTGCTTGTCTCCAGTGACCAGGG + Intronic
1070645983 10:78202902-78202924 CTGCATAGCTGGTGGGCCCAGGG + Intergenic
1070968032 10:80541662-80541684 CTGCCTGTCTGTAGGGACATGGG - Intronic
1070975460 10:80602866-80602888 CTGCTTGAGTGGTGGGACCACGG + Intronic
1071327038 10:84527866-84527888 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1071368137 10:84922370-84922392 CTGTATCTGTGGAGGGACAATGG + Intergenic
1072051304 10:91706282-91706304 TTGAATATCTGGAGAGACCAAGG - Intergenic
1072214613 10:93277494-93277516 CTGCACATCTGGAGACACCAAGG + Intergenic
1072378100 10:94838063-94838085 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1072471944 10:95721146-95721168 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1073176665 10:101561146-101561168 CTTCCTCTCTGGAGGCACCAGGG + Intergenic
1076039487 10:127231955-127231977 CTCCATGTGTGCAGGGACCTTGG - Intronic
1076606112 10:131691083-131691105 CTGCATTTCTGGAGGGCTCTGGG - Intergenic
1076750448 10:132539492-132539514 CCCCATCTCTGGAGAGACCAGGG + Intronic
1076886665 10:133266213-133266235 CTGAGTGCCTGGGGGGACCATGG + Intronic
1077224521 11:1434348-1434370 CTGCGTGTCTGGGGGCACCTAGG + Intronic
1077224537 11:1434403-1434425 CTGCGTGTCTGGGGGCACCTAGG + Intronic
1077224553 11:1434459-1434481 CTGCGTGTCTGGGGGCACCTAGG + Intronic
1077268675 11:1665081-1665103 CCGCATGTCTGGAGTCACCGTGG + Intergenic
1077272100 11:1686222-1686244 CCGCATGTCTGGAGTCACCGTGG - Intergenic
1077467239 11:2739166-2739188 CAGCATGTCTGGGAGGGCCAGGG + Intronic
1077728561 11:4703198-4703220 CTGGTTGTCTGGTTGGACCAAGG + Intergenic
1078278420 11:9873972-9873994 CTCCATCTCTTGAGAGACCACGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1081070548 11:38604721-38604743 CTGCCTCTCTGGAGAGACTAAGG + Intergenic
1085401438 11:76238206-76238228 CTCCCTGTCTGGAGTGTCCAAGG - Intergenic
1085479285 11:76808096-76808118 CTCCATGACAGCAGGGACCAAGG - Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1089922641 11:122224784-122224806 CAGCATGTCTGGAGTGCCCAAGG + Intergenic
1091568632 12:1665152-1665174 CTGCATCCTTGGAGGCACCATGG - Intergenic
1092002923 12:5045836-5045858 CTGCAAGGCTGGGGGGACCCTGG + Exonic
1093416319 12:18925041-18925063 CTGGATGCCTGGAAGGACAAAGG + Intergenic
1093922692 12:24877435-24877457 GGGCATGCCTGGAGGGGCCAAGG - Intronic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1095506246 12:42902180-42902202 CTGAATGTCTGCAGGGCCCCAGG - Intergenic
1095527920 12:43150243-43150265 CTGCATCTCAGGAGAGTCCACGG + Intergenic
1096352098 12:50908968-50908990 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1096457611 12:51800451-51800473 CTGCATCCCTGGAGGGACTGTGG - Intronic
1096770721 12:53934408-53934430 ATCCATGTCTGCAGGGTCCATGG + Intergenic
1097377289 12:58856036-58856058 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1100099130 12:91081014-91081036 CTGCATGGCTGGGGAGGCCATGG + Intergenic
1100855623 12:98755039-98755061 CTGGATGCCAGGAGGGCCCATGG + Intronic
1104346647 12:128005544-128005566 CTGCATTTCTGCAGGGCCCTAGG - Intergenic
1104761068 12:131297825-131297847 CTGCCTTTCTGCAGGGGCCAGGG - Intergenic
1104818709 12:131662967-131662989 CTGCCTTTCTGCAGGGGCCAGGG + Intergenic
1106448997 13:29862872-29862894 CTGGATGTAGGGAGGCACCATGG - Intergenic
1106607439 13:31242173-31242195 CTGCAAGTCAGGAGGCAGCAAGG - Intronic
1107133000 13:36916527-36916549 CTTTATTTCAGGAGGGACCATGG + Intronic
1107381069 13:39857035-39857057 CTGGAAGTCAGGACGGACCAGGG + Intergenic
1107431951 13:40348241-40348263 CTGCATGGCTGGAGCTGCCAGGG + Intergenic
1108876653 13:55057328-55057350 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1111084511 13:83357247-83357269 CTGCAAGTCTGAAGGAACAAGGG - Intergenic
1113208030 13:107940972-107940994 CTAAATGTCTGGAGCGATCATGG - Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1114384292 14:22239958-22239980 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1115961329 14:38838006-38838028 CTGCATTTCTGGGGAGCCCATGG + Intergenic
1117673686 14:58133738-58133760 TTGCATTTCTGGAGGGTCAAGGG + Intronic
1120636568 14:86959626-86959648 CTGCATGGCTGGGGAGACCTAGG + Intergenic
1121017140 14:90555764-90555786 CTTCAGCTCTGGAGAGACCAAGG + Intronic
1121150463 14:91628679-91628701 CTGCATGGCTGGGGAGGCCATGG - Intronic
1121230401 14:92353510-92353532 ATCCATGTCTGGTGGGACAAAGG - Intronic
1121672786 14:95725712-95725734 GGGCATGTGTGGAGGGACTATGG + Intergenic
1122855127 14:104556452-104556474 CTGCACCCCTGGAGGGACGAGGG + Intronic
1123119518 14:105910246-105910268 CTGCATTTCTGGAAGAACAAGGG - Intergenic
1123121723 14:105919839-105919861 CTGCATTGCTGGAGGGACAGGGG - Intronic
1123123254 14:105927791-105927813 CCGCAAGCCTGGAGGGAGCATGG - Intronic
1123404428 15:20011490-20011512 CTGCATTGCTGGAGGGACAGGGG - Intergenic
1123405904 15:20019295-20019317 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1123513761 15:21018137-21018159 CTGCATTGCTGGAGGGACAGGGG - Intergenic
1123515234 15:21025943-21025965 CCGCAAGCCTGGAGGGAGCATGG - Intergenic
1124234916 15:27981830-27981852 CTGAAAGTCTGGGGAGACCAGGG - Intronic
1124838233 15:33216171-33216193 CTCCAGGTCTGGAGAGAGCAGGG + Intergenic
1126198706 15:45960692-45960714 CTACATGAGTGCAGGGACCAGGG + Intergenic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1128362657 15:66973242-66973264 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1128442528 15:67725543-67725565 CAGCATGTCATCAGGGACCATGG - Intronic
1128678656 15:69630142-69630164 CTGCACATGTGTAGGGACCAGGG - Intergenic
1129180373 15:73870501-73870523 CTGCATGTCTCTGGGGACCTAGG - Intergenic
1129388558 15:75208975-75208997 CTGATTGTCTGGAGGGTCAAGGG - Intronic
1130991488 15:88878443-88878465 AGACATGTCTGGAGGGACCTGGG - Intronic
1132222625 15:100116537-100116559 CGCCATGTGTGGAGGGACCCAGG - Intronic
1136508703 16:30722785-30722807 GCGCATGCCTGGAAGGACCAAGG - Intronic
1137845215 16:51680962-51680984 CTGCATGTATTGAGTGGCCATGG + Intergenic
1138419923 16:56892552-56892574 CTGCATGGCTAGAGGGGCCTTGG - Intronic
1138520344 16:57567483-57567505 CAGCAACTCTGCAGGGACCAGGG - Exonic
1139031402 16:62885874-62885896 CTGCATGGCTGGAGAGGCCTTGG - Intergenic
1141063323 16:80894982-80895004 TTGCATGTCTGGAGTGGGCAGGG + Intergenic
1142206353 16:88784959-88784981 CTCCATGGCTGGAGGGCCCAGGG + Exonic
1142867272 17:2798539-2798561 TTCACTGTCTGGAGGGACCAGGG - Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1143910476 17:10244862-10244884 CTGCATAACTGCAGGGGCCAGGG - Intergenic
1146232909 17:31130152-31130174 CTTCATTACTGGAGGGGCCAGGG + Intronic
1146398868 17:32488179-32488201 CTGCAGGGCTGGCAGGACCAGGG + Exonic
1147308281 17:39578562-39578584 CTGGGTCTCTGCAGGGACCATGG - Intergenic
1148074593 17:44928181-44928203 CTGCATGGCGGAAGGGCCCAGGG + Exonic
1148827098 17:50401778-50401800 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1150220675 17:63494126-63494148 CTGGGTGTCTGGATGGGCCAGGG + Intronic
1151346479 17:73505854-73505876 CTGAATGCCTGCAGGGACAAGGG + Intronic
1151667088 17:75551175-75551197 TGGCAACTCTGGAGGGACCAGGG - Intronic
1152013606 17:77735595-77735617 CTGCAGGACTGGAGGGGCCAGGG - Intergenic
1152600536 17:81260030-81260052 CTGCCTGTGTGCAGGGAACATGG - Intronic
1152631413 17:81412193-81412215 CTGCTGGCCTGGAGTGACCAGGG - Intronic
1152693646 17:81733238-81733260 CTGGATGTGTGGGGGGGCCAGGG - Intergenic
1152800187 17:82327235-82327257 CTGCATGGCTGGTGGGACTTGGG + Exonic
1153401518 18:4688292-4688314 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1155349657 18:24894118-24894140 CTGCCTTTCTGCAGGGAGCATGG - Intergenic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1157531776 18:48427365-48427387 CTGCATGGCTGGGGAGACCTTGG + Intergenic
1158467059 18:57699934-57699956 GTGCATGTCTGGCAGGGCCATGG + Intronic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1159930624 18:74309746-74309768 CTGCATGGCTGGGGAGGCCATGG + Intergenic
1162304296 19:9862374-9862396 ATCAATGTCTGGAGGGACCCAGG + Intronic
1162553173 19:11369727-11369749 CTGTGTGTCAGGAGAGACCACGG - Intergenic
1162699397 19:12502326-12502348 CTGCACCTCTGGGGTGACCATGG + Intronic
1163455338 19:17403175-17403197 GAGCAGGTCTGGAGGGGCCATGG - Exonic
1163827681 19:19532797-19532819 CTGCATGACTGCTGTGACCAGGG + Intronic
1164173535 19:22748335-22748357 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1164323166 19:24168661-24168683 CTGCCTTTCTGGAGAGACAAAGG - Intergenic
1165039652 19:33059998-33060020 CTGCATGGCTGCTGGGCCCATGG + Intronic
1165431469 19:35775780-35775802 CCGCAGGACGGGAGGGACCACGG - Intronic
1165444401 19:35849003-35849025 CAGCGTGTCTGCAGGGACCCAGG - Exonic
1167712909 19:51123338-51123360 CTGCAGGTGTGGAGGGCCCCAGG + Intergenic
1168015184 19:53567352-53567374 AAGCTTGTCTGGAGGGGCCAGGG + Intronic
924974169 2:157699-157721 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
927174185 2:20393836-20393858 CAGCAGGTATGGATGGACCATGG - Intergenic
927290405 2:21399525-21399547 CTGCAAGTGTGCAGGGCCCATGG - Intergenic
927311252 2:21634115-21634137 CAGCATGTCAGGAAGGAGCAAGG + Intergenic
928476428 2:31631991-31632013 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
929685948 2:44034913-44034935 CTGCATCCTTGGAGGCACCAAGG + Intergenic
930622585 2:53659377-53659399 GTGCATGTGGTGAGGGACCAAGG + Intronic
931426651 2:62177858-62177880 CTGCCTGTCAGGAAGGACTATGG + Intergenic
932755951 2:74409647-74409669 CTGCATGGCTGGGGAGACCTCGG + Intergenic
932917645 2:75875316-75875338 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
934658908 2:96132758-96132780 CTGTATGTCCGGAGGGATCTGGG - Intronic
934672089 2:96220681-96220703 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935748664 2:106211599-106211621 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
935923828 2:108045072-108045094 CTGCATATCTGGAAGGTCAAAGG - Intergenic
936387328 2:112041875-112041897 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
938246208 2:129779799-129779821 CTTCAGATCTGGAGAGACCAAGG - Intergenic
939516462 2:143174750-143174772 CCCCATATCTGGAGGGACAATGG + Intronic
941339575 2:164290246-164290268 CTGCATGACTGGAGAGGCCTGGG + Intergenic
941673933 2:168324100-168324122 CAGCAGGTCTGAAGGGACCAGGG + Intergenic
942816469 2:180059280-180059302 CTGCCTTTCTGGAGAGACAAGGG + Intergenic
942830778 2:180235912-180235934 CTGCCTTTCTGGAGAGACAAAGG + Intergenic
942991510 2:182208260-182208282 CTGCATGGCTGGTGGGGGCAGGG + Intronic
944039366 2:195336713-195336735 CTGCTTTTCTGGAGAGACTAAGG - Intergenic
944235234 2:197436259-197436281 CTGCAGGTCAGGAGTCACCAGGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
948116251 2:235495617-235495639 CTGCATGTCAGGCAGGGCCATGG + Intronic
949038743 2:241834641-241834663 CTGAAGGGCTGGAGGGACCAGGG - Intergenic
1169889069 20:10433723-10433745 CTGACTGTCTGGAGGGTGCACGG - Intronic
1172477886 20:35252641-35252663 TTGACTGTCTGGAGGAACCAAGG + Intronic
1174504645 20:51009433-51009455 CCTGATGTCAGGAGGGACCAGGG + Intronic
1175697066 20:61110674-61110696 CTAAATGTCTGCAGAGACCAAGG + Intergenic
1176249675 20:64114521-64114543 CTGCAGGGCTGGAAGGGCCATGG + Intergenic
1177896234 21:26858323-26858345 CTGCCTTTCTGGAGCGACTAAGG + Intergenic
1179259153 21:39743009-39743031 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG + Intronic
1179986760 21:44926530-44926552 CTGCTTGGCTGGAGGGCCCTGGG - Intronic
1180224934 21:46386615-46386637 CTGCAGGTGAGGAGGCACCAAGG - Intronic
1180841939 22:18963227-18963249 CTGCAGGTCTGGTGGGGCCGGGG - Intergenic
1181397483 22:22632406-22632428 CCGCATGTCTGGGGTGGCCACGG + Intergenic
1181426864 22:22849288-22849310 CTGTCTGGCTGGAGGGACCAGGG + Intronic
1181937764 22:26450837-26450859 CTGCAGGGCTGGAGAGACCTTGG - Intronic
949119892 3:373215-373237 CTGCTGGTCTGCAGAGACCATGG + Intronic
950744658 3:15077564-15077586 CTGTATGTCTGGATGGACAAAGG + Intronic
950801508 3:15555351-15555373 CTGCAAATATGGAGGGACGAGGG + Intergenic
951200706 3:19873161-19873183 CTGCCTTTCTGGAGAGACTAGGG - Intergenic
954096453 3:48332430-48332452 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
954201522 3:49026038-49026060 CTTTATGTCTGGAGGGATCTTGG + Intronic
956330632 3:68103046-68103068 ATGCATGCATGGAGTGACCAAGG + Intronic
958016282 3:87942968-87942990 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
958629824 3:96671012-96671034 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
960048664 3:113220729-113220751 CAGCTTGTCTGGAGGGATCCAGG - Intronic
960683166 3:120270216-120270238 CCCCATGTCTGGGGAGACCAGGG - Intronic
962151046 3:132893670-132893692 CTGCATCTTGGGATGGACCATGG - Intergenic
962901217 3:139763520-139763542 GAGCATATCTGGAGGGACAATGG - Intergenic
963915747 3:150857591-150857613 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
964662020 3:159130688-159130710 CTGTATGTCAGGAAGCACCAGGG + Intronic
965548016 3:169935016-169935038 CTGCATGTTTGGTGGGACAGAGG + Intronic
965825134 3:172722453-172722475 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
967081356 3:186052677-186052699 CTGCAAGTCTGCTGGGAGCATGG - Intronic
967098781 3:186198756-186198778 CTGCATGTCTGCAGGGCCTATGG + Intronic
968391198 4:194282-194304 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
968750515 4:2386659-2386681 CTCCTTGTCTGGAGGGACTCTGG - Intronic
969457231 4:7307027-7307049 CTGGATGTCTGGAGAAACCTGGG - Intronic
969465276 4:7352775-7352797 CTGCATGTCTTTATGGGCCAGGG + Intronic
970351693 4:15207757-15207779 CTGCATGGCTGGAGAGGCCTTGG - Intergenic
972781367 4:42289521-42289543 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
974175202 4:58313767-58313789 CTGGATCTCTGGAGGCAACATGG - Intergenic
974520447 4:62975263-62975285 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
974941720 4:68477516-68477538 CTGCATTTGTGTAGGGAACAGGG - Exonic
975313836 4:72930278-72930300 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
976189822 4:82477271-82477293 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
976464734 4:85354354-85354376 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
977618031 4:99106831-99106853 CTGCTTTTCTGGAGAGACTAAGG - Intergenic
978069936 4:104454609-104454631 CTGCATGTTCTGAGGGATCAGGG - Intergenic
978909538 4:114048068-114048090 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
979090641 4:116478278-116478300 CTCAAAGTCTGGAGGGGCCAAGG + Intergenic
979669496 4:123347161-123347183 CTGCATCTGGGGAGGGGCCAAGG - Intergenic
980327511 4:131367186-131367208 CTGAATGTCTGGTGGGGTCAAGG + Intergenic
981319816 4:143378914-143378936 CAGCCTCTCTGGAGAGACCATGG + Intronic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
986266147 5:6193046-6193068 TTGCCTGTCAGGAGGGTCCACGG - Intergenic
986707852 5:10466187-10466209 ATGCCTGTCTGGGGGGCCCAAGG + Intronic
987177787 5:15334361-15334383 ATGCATGTCTGGGGGGATGAGGG - Intergenic
987221272 5:15792760-15792782 CTGCTTCTCTGCAGGCACCAAGG - Intronic
987751469 5:22044346-22044368 CTGCATGGCTGGAAGGACTCAGG + Intronic
988457114 5:31396142-31396164 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
988957195 5:36331601-36331623 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
989483514 5:41961435-41961457 GAGCATGCCTGGAGGGACTATGG + Intergenic
990495044 5:56338691-56338713 GTACATGGCTGGAGGGACCCTGG + Intergenic
992003589 5:72457636-72457658 CTGCAGTTCTGGTGGGCCCATGG + Intronic
995465624 5:112447305-112447327 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
996209041 5:120782309-120782331 CTGCATGTATGGAGGGATTGTGG - Intergenic
996272353 5:121621774-121621796 CTGGAAGTCTGAAGAGACCAAGG + Intergenic
997397650 5:133577263-133577285 CTGCATAACTGGAGGAAGCAGGG - Intronic
997665649 5:135627805-135627827 CTCCATGACAGGAGTGACCATGG - Intergenic
999184284 5:149694081-149694103 CTGCTTCTCTGGAGGGACTCTGG + Intergenic
999188038 5:149727467-149727489 CTGCAGCTCTGCAAGGACCAAGG + Intergenic
999519106 5:152332126-152332148 CTGCTTGTGTGGAGGGGGCAGGG + Intergenic
999714571 5:154349864-154349886 CTGGAATTCAGGAGGGACCAGGG - Intronic
1002539276 5:179895301-179895323 TTGCATGTCTGGAAGGAACCAGG - Intronic
1002991354 6:2241904-2241926 CTGCATGTCTGCAGTGTCCAAGG - Intronic
1004236800 6:13881623-13881645 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1006690174 6:35876898-35876920 CTGAGAGTCTGGAGAGACCAAGG + Intronic
1007421126 6:41720383-41720405 CTGCCTGTCTGGAGAGCCCCTGG - Intronic
1007746183 6:44044155-44044177 CTGGAGGCCTGGAGGGGCCATGG - Intergenic
1010082286 6:71877844-71877866 CTGCACTACTTGAGGGACCAAGG + Intergenic
1011076756 6:83446664-83446686 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1011189798 6:84716980-84717002 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1011539880 6:88417901-88417923 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1013895950 6:115088395-115088417 CTGCATGGCTGGAGAGGCCTCGG + Intergenic
1014057123 6:117028954-117028976 CTTCATGGGTGGAGGGAGCAAGG + Intergenic
1016343272 6:143084702-143084724 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1016444737 6:144120065-144120087 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1017656433 6:156633914-156633936 CTGCATGTCTGCAGGTTGCATGG + Intergenic
1018687498 6:166315405-166315427 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1018761028 6:166894527-166894549 CTGCTTTTCTGGAGAGACTAAGG + Intronic
1021140935 7:17023986-17024008 CTGGATATCTTGAAGGACCAGGG + Intergenic
1022112078 7:27238103-27238125 CTGCATGGCTGGAAGGCTCAGGG - Intergenic
1022980765 7:35602741-35602763 CTCCATGTCTTGAGGTACCTAGG + Intergenic
1023439316 7:40169971-40169993 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024422174 7:49181670-49181692 CTGAATGTCTAGAGGAACCTAGG - Intergenic
1024715086 7:52069857-52069879 CTGCATCTGTGAAGGGACCAGGG - Intergenic
1026282339 7:68933098-68933120 CTGCATGCCTGGAGTGAGCAGGG - Intergenic
1026973002 7:74479308-74479330 CTGCATGGCTGGAGTGTGCAGGG - Intronic
1027443499 7:78245809-78245831 CTTCTTTTCTGGAGGGAGCATGG - Intronic
1028588604 7:92474375-92474397 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1030843511 7:114382824-114382846 CTGCCTTTCTGGAGAGACTAAGG - Intronic
1031471503 7:122173923-122173945 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1031657904 7:124380652-124380674 CTGCATCTCTGGATGAACCTGGG + Intergenic
1032419424 7:131765851-131765873 CTGCTTGGCAGGAGGGGCCATGG + Intergenic
1032426110 7:131823351-131823373 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1034249170 7:149674677-149674699 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1034432987 7:151050235-151050257 CTACCTGTGTGGAGGGACAATGG + Exonic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1035533393 8:373129-373151 GTGCGTGTCTGGAAGGACCCTGG - Intergenic
1037934491 8:22906096-22906118 CTGCATCTCTGGAGAGCCCCAGG - Intronic
1041712119 8:60904170-60904192 CTTCCTGTCTGGAGAAACCAGGG + Intergenic
1042056092 8:64766275-64766297 CTGCCTTTCTGGAGAGACAAAGG + Intronic
1045866210 8:106868493-106868515 CTGCATGTGTGCAGGGAGAAGGG - Intergenic
1048765078 8:137834866-137834888 TTCCATGTTTGGAAGGACCAAGG + Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049757072 8:144315477-144315499 CTGCAGGTCTGGGGACACCAGGG + Exonic
1051086002 9:13349748-13349770 CTGCATGTGTGGGGGGGACAGGG - Intergenic
1052529011 9:29657319-29657341 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1052538533 9:29777757-29777779 CTGCCTTTCTGGAGAGACAAAGG - Intergenic
1052591178 9:30497718-30497740 TTGCTGGGCTGGAGGGACCAAGG + Intergenic
1053489149 9:38486918-38486940 CTGTGTGTCTGGAGGAACCGGGG + Intergenic
1054928432 9:70611525-70611547 CTGCATGGCTGAAGAGACCTTGG - Intronic
1056067304 9:82949967-82949989 CTGCATTTCTGCATGGAACATGG - Intergenic
1056202719 9:84291849-84291871 CTGCATATCTGGAGTGATGAGGG + Intronic
1056927524 9:90847547-90847569 CTGCAGGTGTGGAGGGAGCACGG - Intronic
1057043456 9:91864690-91864712 TGGCATGTCAGAAGGGACCAGGG + Intronic
1057220745 9:93256477-93256499 CTGCCTGCCTGGAGGGACAGTGG - Intronic
1059611283 9:115899371-115899393 CTGGATGTTTGGAGGAACAAAGG + Intergenic
1060218289 9:121751441-121751463 CTGTCTGTCTGGAGAGACCAGGG + Intronic
1060670063 9:125460922-125460944 CTGGATTTCTGGAGGAAGCAGGG + Intronic
1061424918 9:130492824-130492846 CTGCAGGTCTGGGGGGTGCAGGG + Intronic
1062050062 9:134442596-134442618 CTGCCTGGCTGGTGGGAGCACGG - Intergenic
1062181834 9:135195136-135195158 CTGCAGGTCTGGGGGGTACATGG - Intergenic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062214570 9:135382256-135382278 CTGCACTGCTGTAGGGACCAAGG - Intergenic
1187027294 X:15448790-15448812 CTGCTTGTGTGGATGGAGCAAGG - Intronic
1187246741 X:17559697-17559719 TTGCATGTCTGGACTGCCCAGGG - Intronic
1187455787 X:19440165-19440187 CCGCTTGGCTGGAGGGACCCAGG - Intronic
1192934733 X:75848056-75848078 CTGCTGCACTGGAGGGACCATGG + Intergenic
1192939990 X:75902011-75902033 CTGCCTTTCTGGAGAGACTAAGG - Intergenic
1193010471 X:76669811-76669833 CTGCAGTACTGGAGGGGCCAAGG - Intergenic
1193306692 X:79959372-79959394 CTGCCTTTCTGGAGAGACTAAGG + Intergenic
1193815163 X:86096154-86096176 ATGCACGTCTGGAGGGATGATGG - Intergenic
1198427535 X:136535080-136535102 CAGCATGTCTTGAGGGCCCACGG + Intronic
1200018758 X:153184439-153184461 CTGCCTGGCTGGGAGGACCAGGG + Intergenic
1200061318 X:153485036-153485058 CTGCATGGCCACAGGGACCAGGG + Intronic
1200844233 Y:7815002-7815024 CTCCATGTCAGGAGGGCCTAAGG + Intergenic