ID: 981613103

View in Genome Browser
Species Human (GRCh38)
Location 4:146617772-146617794
Sequence CTGGGCCAGCAGGTCTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981613096_981613103 1 Left 981613096 4:146617748-146617770 CCAATTCCTCTTGCCATAATATG No data
Right 981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG No data
981613095_981613103 12 Left 981613095 4:146617737-146617759 CCATAAATTTTCCAATTCCTCTT No data
Right 981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG No data
981613094_981613103 24 Left 981613094 4:146617725-146617747 CCAGAAGCATTTCCATAAATTTT No data
Right 981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG No data
981613098_981613103 -5 Left 981613098 4:146617754-146617776 CCTCTTGCCATAATATGACTGGG No data
Right 981613103 4:146617772-146617794 CTGGGCCAGCAGGTCTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981613103 Original CRISPR CTGGGCCAGCAGGTCTATCT GGG Intergenic
No off target data available for this crispr