ID: 981614533

View in Genome Browser
Species Human (GRCh38)
Location 4:146633388-146633410
Sequence CTAAGGCATCCAGCCAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981614525_981614533 13 Left 981614525 4:146633352-146633374 CCCACCAGACGGAATTGAGAGGG No data
Right 981614533 4:146633388-146633410 CTAAGGCATCCAGCCAACCTGGG No data
981614528_981614533 9 Left 981614528 4:146633356-146633378 CCAGACGGAATTGAGAGGGCGTC No data
Right 981614533 4:146633388-146633410 CTAAGGCATCCAGCCAACCTGGG No data
981614523_981614533 23 Left 981614523 4:146633342-146633364 CCTTAGCAAACCCACCAGACGGA No data
Right 981614533 4:146633388-146633410 CTAAGGCATCCAGCCAACCTGGG No data
981614527_981614533 12 Left 981614527 4:146633353-146633375 CCACCAGACGGAATTGAGAGGGC No data
Right 981614533 4:146633388-146633410 CTAAGGCATCCAGCCAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981614533 Original CRISPR CTAAGGCATCCAGCCAACCT GGG Intergenic
No off target data available for this crispr