ID: 981615276

View in Genome Browser
Species Human (GRCh38)
Location 4:146638585-146638607
Sequence CGATTGTGAGTAGCAGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981615271_981615276 4 Left 981615271 4:146638558-146638580 CCATTTGGGTGGGGTTGAGTGGG 0: 1
1: 0
2: 1
3: 33
4: 231
Right 981615276 4:146638585-146638607 CGATTGTGAGTAGCAGCCGCGGG No data
981615262_981615276 28 Left 981615262 4:146638534-146638556 CCGGCGACTGGAGCGCGGACCTG No data
Right 981615276 4:146638585-146638607 CGATTGTGAGTAGCAGCCGCGGG No data
981615261_981615276 29 Left 981615261 4:146638533-146638555 CCCGGCGACTGGAGCGCGGACCT No data
Right 981615276 4:146638585-146638607 CGATTGTGAGTAGCAGCCGCGGG No data
981615269_981615276 9 Left 981615269 4:146638553-146638575 CCTGGCCATTTGGGTGGGGTTGA No data
Right 981615276 4:146638585-146638607 CGATTGTGAGTAGCAGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981615276 Original CRISPR CGATTGTGAGTAGCAGCCGC GGG Intergenic
No off target data available for this crispr