ID: 981615371

View in Genome Browser
Species Human (GRCh38)
Location 4:146638996-146639018
Sequence CAGAGTCCGGAGGCGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981615365_981615371 -8 Left 981615365 4:146638981-146639003 CCGAGATCAGGCGTACAGAGTCC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 981615371 4:146638996-146639018 CAGAGTCCGGAGGCGGCGGCGGG 0: 1
1: 0
2: 2
3: 30
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981615371 Original CRISPR CAGAGTCCGGAGGCGGCGGC GGG Exonic
900117486 1:1034764-1034786 TAGAGGCTGGAGGCCGCGGCGGG + Intronic
900180351 1:1308476-1308498 CAGAGTCGGGGAGCGGAGGCGGG - Intronic
900633650 1:3651716-3651738 CCGAGCCCACAGGCGGCGGCCGG + Intronic
900658322 1:3771108-3771130 CAGAATGCGGAGCCGGGGGCAGG - Intronic
901022271 1:6261352-6261374 CGGCGTCCGAAGGCGGCGTCCGG - Intergenic
901075863 1:6554383-6554405 CAGGCTCCCGAGCCGGCGGCGGG + Exonic
901231054 1:7641950-7641972 CAGAGGCCGGGGGCTGCGGGTGG - Intronic
901717391 1:11167479-11167501 CAGCAGCCGGAGGCAGCGGCCGG - Exonic
902237040 1:15064161-15064183 CAGAGTGAGGAGGGGGCTGCAGG + Intronic
903286008 1:22277205-22277227 CAGAGGCCGGTGGGGGAGGCTGG + Intergenic
903791399 1:25895599-25895621 CAGAGTCCGCTGACGGCCGCTGG + Intronic
903907388 1:26696448-26696470 CCGAGGGCGGCGGCGGCGGCGGG - Exonic
905308389 1:37034076-37034098 CAGACTCCGGAGGCGCCGCCAGG + Exonic
905463071 1:38134002-38134024 CCGAGGAGGGAGGCGGCGGCCGG + Intergenic
905778456 1:40686543-40686565 CATACTCGGGAGGCTGCGGCAGG + Intergenic
905874646 1:41424058-41424080 CACAGCCCCGAGGCAGCGGCTGG - Intergenic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
906465117 1:46071580-46071602 CAGACTCAGGAGGCTGAGGCAGG + Intronic
907320531 1:53599405-53599427 CAGAGTCCCGAGGTGGCGCAGGG - Intronic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
907767384 1:57424205-57424227 CACGGCCCGGCGGCGGCGGCCGG - Intronic
908738960 1:67307812-67307834 CAGAGGCGGGAGGCGGAGGCGGG + Exonic
909962346 1:81861773-81861795 CAGACTCGGGAGGCTGAGGCAGG + Intronic
910449567 1:87331653-87331675 CAGTGGGCGGAGGCGGGGGCTGG + Intronic
914694708 1:150067019-150067041 CAGAGCGCCGAGGCGGGGGCGGG + Intergenic
916548293 1:165827476-165827498 CAGAGACCTCGGGCGGCGGCGGG + Intronic
917152718 1:171962013-171962035 CAGAGTCCTGAGGTGGCAGAGGG + Intronic
917606181 1:176632415-176632437 AAGACTCCGGAGGCTGAGGCAGG + Intronic
917898885 1:179521071-179521093 CATAGTCCGGAGGCTGAGGTGGG - Intronic
918587078 1:186200600-186200622 CAGAATCGGGAGGCTGAGGCAGG - Intergenic
920069280 1:203290694-203290716 CAGACTCCGGAGGGGCCGGCAGG + Intergenic
920294657 1:204948523-204948545 CAGAGTCCTGAGGCCCCAGCTGG + Intronic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
924052337 1:240091995-240092017 GAGAGTCAGGCGGCGGCGGGGGG - Exonic
924739932 1:246789097-246789119 CAGAGACCGGCAGCGGCGGGCGG + Intergenic
924787322 1:247210587-247210609 CAGACTCCGGAGGCAGCTGTGGG + Intergenic
1062861372 10:813003-813025 CAGAGACCAGAGGCGGCCGGCGG - Exonic
1065099079 10:22316237-22316259 GGGAGGCCGTAGGCGGCGGCTGG + Exonic
1065239801 10:23694434-23694456 CAGAGTTTGGAGGCGACCGCAGG - Intergenic
1065520541 10:26567191-26567213 TGAAGTCCGGGGGCGGCGGCGGG - Exonic
1066402608 10:35090355-35090377 CCGGGGCCGGTGGCGGCGGCCGG - Exonic
1069622921 10:69848952-69848974 CTGAGTACAGAGGCAGCGGCAGG - Intronic
1070151804 10:73809981-73810003 CAGACTCAGGAGGCTGAGGCCGG - Intronic
1070974121 10:80591442-80591464 CAGAGTCCCGAGGCAGTGGAAGG + Intronic
1071086823 10:81875235-81875257 CGGGCTCCGGCGGCGGCGGCGGG - Intergenic
1072159051 10:92749450-92749472 CAGAGTCCTGAGGCAGCGCAGGG + Intergenic
1072802563 10:98403291-98403313 CAGATTCTGGAGGCAGCGGATGG - Intronic
1075278010 10:121112818-121112840 CAGAGTCCAGAGGAGGGAGCAGG + Intergenic
1075748522 10:124744344-124744366 CGGCGTGCGGCGGCGGCGGCAGG + Intronic
1076035581 10:127196425-127196447 CAGGGCCAGGAGGCGGGGGCGGG + Intronic
1076410284 10:130244432-130244454 CAGAGGCCGCAGGCTGAGGCTGG - Intergenic
1076616653 10:131759540-131759562 CGGAGACCGGAGGCTGCGGGAGG + Intergenic
1076792516 10:132784861-132784883 CAGAATCCGGGGGCGGCCCCGGG - Exonic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1082807145 11:57458612-57458634 GAGGGCCTGGAGGCGGCGGCGGG - Intergenic
1083424189 11:62574565-62574587 CCGAGTCCGGAGGAGGTGGGAGG - Exonic
1083428418 11:62601458-62601480 GTGCGGCCGGAGGCGGCGGCGGG - Exonic
1084491261 11:69479863-69479885 GAGAGGCCAGAGGAGGCGGCAGG - Intergenic
1087832180 11:102831530-102831552 CAGAGTCCCGTGGCCGCGGAGGG + Intergenic
1089564595 11:119364073-119364095 CACAGTCCGGACGCCGAGGCCGG + Intronic
1089854677 11:121532795-121532817 CAGACTCAGGAGGCTGAGGCAGG - Intronic
1090020959 11:123127923-123127945 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1090478351 11:127045618-127045640 CAGAGCCCAGAGGTGGCAGCAGG - Intergenic
1091303872 11:134524287-134524309 CAGGGTCCTGAGGCGGGAGCCGG - Intergenic
1092162623 12:6324299-6324321 AAGAGGCTGGAGGAGGCGGCGGG - Intronic
1092163440 12:6328526-6328548 CTGTGTCCGGAGGCTGAGGCGGG + Intergenic
1094744176 12:33324644-33324666 CAGAGTCTGGAGGCGGAGCAGGG + Intergenic
1095954425 12:47798229-47798251 CAGAGTCAGGAGGGGGCTGGAGG + Intronic
1096101013 12:48970493-48970515 CCGAGGGCGGAGGCCGCGGCCGG + Exonic
1096249406 12:50018951-50018973 CAGTGTCAGGAGGCTGAGGCCGG - Intronic
1096396567 12:51270411-51270433 CAGAGGCCGGAGGGGGTGGGGGG + Exonic
1096863764 12:54549328-54549350 CAGAGTGCAGCGGAGGCGGCGGG - Exonic
1098346251 12:69506998-69507020 CAGAGTCCTGAGGCAGCAGAGGG - Intronic
1098426021 12:70366400-70366422 GAGAGTGCGGGGGCGGAGGCTGG + Exonic
1098455765 12:70671895-70671917 CAGAGCCTGGCGGCGGTGGCTGG - Intronic
1099956088 12:89353635-89353657 CAAAGGGAGGAGGCGGCGGCAGG - Intergenic
1101751064 12:107582749-107582771 CACAGTCCGGTGGCAGAGGCTGG - Intronic
1102922018 12:116798678-116798700 CAGATTCAGGAGGCTGAGGCGGG - Intronic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106246437 13:27954069-27954091 CAGACGCCGGAGGCCGCGGGCGG + Intergenic
1107133465 13:36920143-36920165 CAGGGCCCGGCGGCGGCGGCGGG + Exonic
1109789653 13:67230386-67230408 CAGAGCCCGGGGGCGGGGCCTGG - Intronic
1110318200 13:74134286-74134308 CCGAGGGCGGGGGCGGCGGCGGG + Intergenic
1112419934 13:99239479-99239501 CAGAGTCTGGTGGTGGCGCCTGG + Intronic
1114836169 14:26205103-26205125 CAGAGTCGGGCTGCGGCGGGCGG - Intergenic
1115664845 14:35534817-35534839 CAGAGTCTGAAGCGGGCGGCCGG + Exonic
1117803048 14:59464688-59464710 CAGGGCCCCGCGGCGGCGGCAGG + Exonic
1119330151 14:73787333-73787355 CAGAGTGGGGAGACGGCGCCTGG - Intronic
1120993494 14:90397926-90397948 GAGAGGGCGGAAGCGGCGGCCGG + Intronic
1121417479 14:93788956-93788978 CAGCGGCGGGAGGCGCCGGCAGG + Intergenic
1121595280 14:95157434-95157456 CAGTCTCCGCAGGCGCCGGCGGG - Intronic
1122900302 14:104779635-104779657 CAGAGTCCTGAGGCCGAGGCTGG - Intronic
1122900316 14:104779677-104779699 CTGAGTCCCGAGGCCGAGGCCGG - Intronic
1122900330 14:104779719-104779741 CCGAGTCCCGAGGCCGAGGCTGG - Intronic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126099632 15:45111610-45111632 CCGGGTCGAGAGGCGGCGGCGGG + Intronic
1129226874 15:74175280-74175302 CAGAGCACGGAGGCTGCGGAAGG - Exonic
1129539974 15:76341318-76341340 CAGAGTCCCGAGGTCGGGGCGGG - Intronic
1129612271 15:77070629-77070651 CCGAGCGCGGAGGCGCCGGCTGG + Intronic
1129710993 15:77820125-77820147 CGGAGAGCGGAGGGGGCGGCGGG - Intronic
1129844426 15:78761771-78761793 CACATGCTGGAGGCGGCGGCAGG + Intronic
1130348964 15:83073811-83073833 CAGAGTCCAAAGGTGGCTGCAGG + Intergenic
1130564301 15:84981267-84981289 CGGCGTCCGGAGGAGGTGGCGGG + Intronic
1132324937 15:100961144-100961166 CAGAGTCCTGAGGTGGTGCCGGG + Intronic
1132579814 16:679815-679837 CAGGGGCGGGAGGCGGCGGCTGG + Intronic
1132584676 16:700952-700974 AAGGATCCGGAGGAGGCGGCGGG + Intronic
1132923799 16:2416247-2416269 CAGAGGCGGGAGGCTGAGGCGGG + Intergenic
1135656656 16:24256130-24256152 CAGAGTCCTGGGGCGGGGGCCGG - Exonic
1135845943 16:25918691-25918713 CAGAGTGCTGAGGCTGAGGCTGG + Intronic
1136003540 16:27313775-27313797 GACTGTCCGGCGGCGGCGGCGGG + Intronic
1136558790 16:31025985-31026007 CAGAGACCTGAGACGGGGGCCGG + Intergenic
1137288779 16:47037744-47037766 GGGGCTCCGGAGGCGGCGGCTGG + Intergenic
1137521532 16:49199363-49199385 CAGAGCCAGGAGGCAGCGGGAGG - Intergenic
1138651699 16:58464515-58464537 CGGACTCCGGGCGCGGCGGCCGG + Intronic
1141377058 16:83541114-83541136 CAGAGGCTGGAGGTGGCAGCTGG - Intronic
1141651952 16:85397532-85397554 CAGAAGCTGGAGGCAGCGGCGGG - Intergenic
1141774933 16:86116847-86116869 CAGAGTCCAGTGGAGGCTGCAGG + Intergenic
1141825323 16:86475007-86475029 CAGAGTCCAGAGGCTGAGGCAGG - Intergenic
1144872590 17:18380356-18380378 CAGAGTCGGGGAGCGGGGGCAGG - Intronic
1145063133 17:19744771-19744793 CAGAGGGCGGAAGAGGCGGCGGG + Intronic
1145963853 17:28903051-28903073 CAGCCTCCGAAGGCGGAGGCGGG + Exonic
1147960316 17:44163409-44163431 CAGCTTCCGGAGGCTGAGGCAGG - Intergenic
1147971164 17:44219709-44219731 CTGAGGCCGGGGCCGGCGGCGGG - Intronic
1148151106 17:45396812-45396834 CTGAGTCAGGAGGCAGCGCCAGG + Intronic
1148564488 17:48625160-48625182 CAGAGTCCGCAACCGGCGACAGG - Intronic
1148783582 17:50134723-50134745 CAGAGCCCGGAGGCTGGGCCTGG - Exonic
1149772366 17:59331900-59331922 GGGAGTCCGGAGGCCGGGGCCGG - Intronic
1151375109 17:73683081-73683103 CAGAGACCTGAGGTGGAGGCTGG - Intergenic
1151540850 17:74763919-74763941 CAGAGTCCAGTGACGGGGGCCGG + Intronic
1151558908 17:74860600-74860622 CAGAGACCGGCGCAGGCGGCTGG + Intronic
1151715998 17:75831336-75831358 CAGGGTCAGGAGGCTGGGGCGGG + Exonic
1152067025 17:78117605-78117627 CAGGGTCCGGAAGGGGCCGCAGG + Exonic
1152212424 17:79009574-79009596 CAGGGTCGGAGGGCGGCGGCAGG + Intronic
1152286481 17:79415929-79415951 CAGAGTCTGGGGGCGTCTGCAGG - Intronic
1152736985 17:82001792-82001814 CAGAGTCTGGAGGCTGCTCCTGG - Intronic
1156350373 18:36297491-36297513 CAAAGGCCGGCGGCGGAGGCGGG - Intergenic
1156448482 18:37253690-37253712 CGGAGGCCGGAGGAGGCGGCGGG + Intronic
1160028828 18:75241233-75241255 CAGAGTCCGGAGTGGGCTGGGGG + Intronic
1160454691 18:78992426-78992448 CAGGGGCCGCAGGCGGGGGCCGG - Exonic
1160734354 19:655372-655394 CAAAGTCGGGAGGCTGAGGCAGG + Intronic
1160897107 19:1408069-1408091 GGAAGTCTGGAGGCGGCGGCGGG - Intronic
1161017995 19:1992928-1992950 CCGAGGCTGGAGGCGGAGGCGGG - Intronic
1161039679 19:2103586-2103608 CTGAGTCCAGAGGCCGCTGCCGG + Intronic
1161247116 19:3259269-3259291 CAGTGTCCTGGGGCGGGGGCAGG - Intronic
1161332889 19:3696724-3696746 CAGAGTGCGGAGGGGAGGGCAGG + Intronic
1161960634 19:7521009-7521031 CAGAGCCCGGAGGCAGTGGGAGG - Exonic
1162164996 19:8746450-8746472 CAGAGGCGGGAGGCCGAGGCAGG + Intergenic
1162604249 19:11694700-11694722 CAGAGCCCGGAGTCGCTGGCTGG + Intergenic
1163466295 19:17470238-17470260 CAGGGTCCGGGGGCGGAGCCTGG + Intronic
1163755768 19:19105460-19105482 CAAAGTGCGGAGGCGGGGCCGGG - Intronic
1164582920 19:29446082-29446104 CCTAGTCGGGAGGCGGAGGCAGG - Intergenic
1164937341 19:32224555-32224577 CCGAGTCCCCGGGCGGCGGCGGG + Intergenic
1164974543 19:32562092-32562114 CAGCTTCCGGAGGCTGAGGCAGG + Intergenic
1166301771 19:41915202-41915224 ACGTGTCCGGAGGAGGCGGCGGG - Intronic
1166351181 19:42199184-42199206 TAGCCTCCGGAGGCGGGGGCTGG - Exonic
1166838400 19:45681658-45681680 CAGAGGGCGGGGGCGGCGGCCGG - Intronic
1166857944 19:45792542-45792564 CCGGGACCGGAGGCGGAGGCAGG + Exonic
1166871320 19:45872758-45872780 CAGGGGCTGGAGGCGGGGGCTGG - Exonic
1167428808 19:49442903-49442925 CAGATTCCGGGGGCGGAGGCAGG - Intergenic
1167439424 19:49499914-49499936 CAGAGACCGGAGGGGGCGGGGGG - Intergenic
1167743890 19:51340034-51340056 CAGCGAGCGGCGGCGGCGGCCGG + Exonic
1167756890 19:51418314-51418336 CAGACTCAGGAGGCTGAGGCAGG - Intergenic
1168643376 19:58044638-58044660 CGGTGACCCGAGGCGGCGGCGGG - Intronic
925822728 2:7816211-7816233 CAAAGTCTGGAGGCTGGGGCTGG + Intergenic
926108311 2:10166281-10166303 CAGAGACCAGAGCCGGCTGCAGG + Intronic
926623385 2:15068949-15068971 CAGAGTCCCGAGGCAGCGCAGGG + Intergenic
926678048 2:15642972-15642994 GAGAGTCGGGAGGCGGGGGACGG - Intergenic
929218226 2:39437507-39437529 AAGCGTCCGGCGGCAGCGGCCGG - Intergenic
930051464 2:47219317-47219339 CAGAGTCCAGAGGCTGCTGGAGG + Intergenic
932036450 2:68251902-68251924 CAGAGGCCGGGGGCGGGCGCGGG + Intronic
932331501 2:70900668-70900690 CGGAGTCTGGTGGCGGCGGTGGG + Exonic
933613338 2:84459311-84459333 CAGAGGCCGGAGGAGGCAGAGGG + Exonic
934588247 2:95525321-95525343 CAGCGGCCGGAGGCGTGGGCTGG - Intergenic
938008128 2:127805583-127805605 CAGAGTCAGGAAGGGGCAGCAGG + Intronic
941131072 2:161651105-161651127 CTGAGTCCGGAGGCGGGGTGGGG - Intronic
941916435 2:170816820-170816842 CAGAGTGGGGAGGCGGGGACCGG - Exonic
942461660 2:176172383-176172405 GAGACCCGGGAGGCGGCGGCAGG - Exonic
942890368 2:180980635-180980657 CCGAGCCGGGCGGCGGCGGCGGG + Exonic
945610996 2:212002945-212002967 CAGACTCGGGAGGCTGTGGCAGG + Intronic
948216643 2:236237569-236237591 CTGGGTCCGGAGGCGGGGGCTGG + Intronic
948242544 2:236449509-236449531 CACAGTCCGGAGGCGGGGGCTGG + Intronic
1168965126 20:1894337-1894359 CGGAGTCCGGAGGCGAGGGGAGG + Exonic
1171011803 20:21513086-21513108 CGGAGTCCGGGGGCTGCGGCTGG + Intronic
1172841008 20:37902907-37902929 CCGAGTGCGGAGGCGGGGCCGGG - Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174054097 20:47785965-47785987 CCGAGTCCGGAGGCATCGGGAGG - Exonic
1174163963 20:48571437-48571459 CAGTGGCCGGAGGCGGAGCCAGG + Intergenic
1175943084 20:62546829-62546851 CAGAGTCCTGGGGCTGGGGCAGG + Intergenic
1176029993 20:63007190-63007212 GGGCGGCCGGAGGCGGCGGCCGG - Intergenic
1176549733 21:8216029-8216051 CGGAGGGCGGCGGCGGCGGCGGG + Intergenic
1176557624 21:8260258-8260280 CGGAGGGCGGCGGCGGCGGCGGG + Intergenic
1176568658 21:8399063-8399085 CGGAGGGCGGCGGCGGCGGCGGG + Intergenic
1181265846 22:21630064-21630086 CAGCGTCCGGGGGCGGGGCCTGG - Exonic
1181765290 22:25087160-25087182 AAGATCCCGGAGGCAGCGGCGGG - Intronic
1181801096 22:25348497-25348519 CAGAGCCCTGAGGCGGAGGCAGG - Intergenic
1182122668 22:27797721-27797743 CGGTCTCCGGGGGCGGCGGCCGG - Exonic
1182122838 22:27798338-27798360 CAAAGTCCGGCGGCGGGGGCCGG + Exonic
1182469952 22:30542383-30542405 CGGAGTCCGGAGGCGAGGGGAGG + Intronic
1182896850 22:33866093-33866115 CTGAGGCCGGAGGCTGAGGCAGG - Intronic
1183352205 22:37340598-37340620 GAGAGCCAGGAGGCGGCGTCAGG + Intergenic
1183901022 22:41006097-41006119 CAGAATCCGGAAGCTGAGGCAGG + Intergenic
1184320855 22:43741207-43741229 CAGAGCCCGGAGACCGTGGCTGG - Intronic
1184640488 22:45867641-45867663 CAGAGGCCGGAGGCGGCGCTTGG - Intergenic
1185116243 22:48939849-48939871 CAGACTCAGGGGGAGGCGGCCGG + Intergenic
950940340 3:16884966-16884988 CGGCGGCCCGAGGCGGCGGCGGG + Intronic
953981147 3:47413739-47413761 TACAGTCAGGAGGCAGCGGCTGG + Exonic
954025660 3:47781541-47781563 CCGGGGCCGGAGGCGGCAGCTGG - Intronic
955184065 3:56698416-56698438 CAGACTCGGGAGGCTGAGGCAGG - Intergenic
955687537 3:61561986-61562008 CAGGGCGCGGAGTCGGCGGCCGG - Exonic
956464605 3:69506645-69506667 CAGACTCAGGAGGCTGAGGCAGG - Intronic
956743642 3:72294271-72294293 CAGAGTCCTGAGGTGGCGCAGGG - Intergenic
958785616 3:98593640-98593662 CGGGCTCCGGAGGCGGGGGCGGG + Exonic
960708224 3:120502183-120502205 CAGAATCAGGTGGCGGTGGCTGG - Intergenic
961313571 3:126019140-126019162 CAGAGTCCGGAGGTGGCGCAAGG + Intronic
961827510 3:129606700-129606722 GGGAGCCCGGAGGCGGCGGGAGG + Exonic
966442269 3:179958913-179958935 CAGATTCCTGAGGCTGAGGCAGG + Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
968671752 4:1855878-1855900 CGGTGTACCGAGGCGGCGGCGGG + Exonic
968694322 4:2014904-2014926 CAGAGGCGGGAGGCAGAGGCAGG - Intronic
969432501 4:7163938-7163960 CAGACTCAGGAGGCTGAGGCAGG + Intergenic
969715829 4:8867724-8867746 AAGGGCACGGAGGCGGCGGCCGG + Exonic
971351927 4:25862953-25862975 GCGGGTCCGGAGGTGGCGGCAGG - Exonic
978816410 4:112911409-112911431 CATACTCCGGAGGCTGAGGCAGG + Intronic
979018897 4:115469082-115469104 CAGAGTCCAGAGGTGGCAGGGGG - Intergenic
981615371 4:146638996-146639018 CAGAGTCCGGAGGCGGCGGCGGG + Exonic
985472398 5:53997-54019 CTGAGACCGGGGGCGGCGCCTGG + Intergenic
985504661 5:271970-271992 CAGGGGTCGGGGGCGGCGGCAGG - Intronic
986475002 5:8120883-8120905 CAGAATCCTGAGGCAGCTGCAGG + Intergenic
987050410 5:14143579-14143601 CAGAGCCCCGGGGCGGCGGGGGG - Intergenic
993502685 5:88680458-88680480 CACAGTCCCGGGGCGGGGGCGGG + Intergenic
995354705 5:111224395-111224417 CTGCGTTCGCAGGCGGCGGCTGG + Exonic
995848862 5:116523423-116523445 CAGACTCGGGAGGCTGAGGCAGG - Intronic
998004732 5:138649382-138649404 CAGACTCTGGGGGCGGGGGCAGG + Intronic
998252763 5:140563876-140563898 CACAGTCTGGAGGTGGAGGCTGG - Exonic
1000257700 5:159556420-159556442 CAGATTCTGGAGGCAGTGGCTGG + Intergenic
1001484075 5:172107067-172107089 CAGAGTCCTGGGGAGGGGGCGGG + Intronic
1001557555 5:172646935-172646957 GAAAGTCTGGAGGCGGGGGCCGG + Intronic
1003377492 6:5593290-5593312 CAGAGGCCGGTGGGGGCGGGAGG - Intronic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1006519521 6:34563277-34563299 CAGAGGCAGAAGGCAGCGGCTGG - Intergenic
1009967392 6:70592039-70592061 CAGAGTCCTGAGGCAGCGCAGGG - Intergenic
1018998335 6:168726963-168726985 CAGCGTCGGGAGGCTGAGGCAGG - Intergenic
1019075570 6:169384788-169384810 CAGAGTCCTGAGGCAGCAGCAGG - Intergenic
1019533268 7:1514227-1514249 CGGAGGCCGGAGGCGGAGGCAGG + Intergenic
1019710955 7:2518100-2518122 CTCAGTCCGGAGGCTGGGGCTGG + Intronic
1019719317 7:2558957-2558979 CAGAGTCCGCGGGCGCCGGCCGG - Intergenic
1022428005 7:30285719-30285741 CTGAGGACGGCGGCGGCGGCCGG + Exonic
1025069712 7:55887703-55887725 CGGAGGCGGGAGGCGGAGGCGGG + Intronic
1026024570 7:66734195-66734217 CAGAGTCCGGGGGCAGCTGATGG + Intronic
1026889267 7:73972735-73972757 CAGAGTCCGGGGGCAGCTGATGG + Intergenic
1028445941 7:90924185-90924207 CAGAGTCCTGAGGCGGTGCAGGG + Intronic
1028597958 7:92566925-92566947 CTGAGGCCGGGGGCAGCGGCTGG + Intronic
1028997151 7:97113584-97113606 CAGAGACGGGAGGCTGAGGCAGG - Intergenic
1029601173 7:101564207-101564229 CAGCGGCCGGAGGCAGAGGCAGG - Intergenic
1031966571 7:128031709-128031731 GAGAGTCCGGGGGCGGGCGCGGG + Intronic
1032842821 7:135727451-135727473 CCGAGTCCGGAAGCTGCTGCTGG - Exonic
1033014787 7:137661275-137661297 CAGAGGCCAGAGGCTGCTGCAGG + Intronic
1034147101 7:148883703-148883725 CTGAGTGCGGACTCGGCGGCTGG + Intronic
1034222763 7:149459423-149459445 CAGAGGCCGGAGGCAGAGGCTGG + Intronic
1034251297 7:149692836-149692858 CAGGGTGCGGAGGCGAGGGCGGG - Intergenic
1035197216 7:157231683-157231705 CAGAGTCCGGAGGCGGCACAGGG - Intronic
1035403978 7:158586937-158586959 TAGAGGCAGGAGGCGGCGCCGGG + Intronic
1037821883 8:22139042-22139064 CAGAGTCAGGGGGCGCTGGCCGG - Exonic
1038913096 8:31989133-31989155 CAGACTCAGGAGGCTGAGGCAGG + Intronic
1040386867 8:46920021-46920043 CAGAGCCCAGAGGCAGCTGCAGG - Intergenic
1040630312 8:49202536-49202558 CAGACTCGGGAGGCTGAGGCAGG - Intergenic
1042155566 8:65841544-65841566 CAGGGGCCGGCGGCCGCGGCAGG - Exonic
1044975043 8:97656414-97656436 CAGACTCGGGAGGCTGAGGCAGG - Intronic
1045510130 8:102807104-102807126 CAGACTTCGGAAGCGGCCGCCGG - Intergenic
1047040037 8:120983247-120983269 CAGAGTGCGGAGGCAGGAGCTGG + Intergenic
1048299152 8:133238846-133238868 CAGAGTCCGGGGGCGGCAGCTGG + Exonic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049194552 8:141308184-141308206 CGGGGTCGGGAGGCGGCTGCGGG + Intronic
1049206585 8:141366451-141366473 CAGGGTCCCGAGGGGGCAGCGGG - Intronic
1049254218 8:141605284-141605306 CAGAGCCCGGAGGCGCAGGGAGG + Intergenic
1049324731 8:142016037-142016059 CAGAGGCAGGAGGTGGCGACTGG - Intergenic
1049358862 8:142202355-142202377 CAGAGGGCGGAGACGGCGGCTGG - Intergenic
1049462969 8:142738658-142738680 CTGAGCCCAGAGGCGGTGGCTGG - Intergenic
1049682234 8:143924548-143924570 CAGAGGCTGGAGGCCGAGGCCGG - Exonic
1053153415 9:35757036-35757058 CAGGTCCCGGAGGGGGCGGCTGG + Exonic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1056621775 9:88220917-88220939 CAGAGTCCGGGTGCCGCGTCAGG - Intergenic
1057504998 9:95626610-95626632 CAGAGACCAGAGGAAGCGGCTGG - Intergenic
1058467614 9:105244835-105244857 AGGAGCCCGGAGGCGGCGCCGGG - Exonic
1059744571 9:117187655-117187677 CAGAGTCCTGAGGCAGCGCAGGG - Intronic
1061410543 9:130418904-130418926 CAGGGTCCGGAGCCGCCGGCTGG - Exonic
1061587973 9:131580549-131580571 CAGAGGCCAGAGGCTGAGGCGGG - Intronic
1062473617 9:136717340-136717362 CAGGGGCCGGAGGTGGGGGCAGG - Intronic
1203772864 EBV:58228-58250 CAGAGGCCGGAGACGACGGCGGG + Intergenic
1186500254 X:10045090-10045112 CAGAGTCTGGTGGGGGCGTCTGG + Intronic
1186576048 X:10766795-10766817 CTGAGTCAGGAGGCTGAGGCGGG + Intronic
1188004389 X:25007208-25007230 CCGAGCCCGGAGGCGGAGGTAGG + Exonic
1190583697 X:51915539-51915561 CAGAGTCCCGAGGCGGCTCAGGG - Intergenic
1190667529 X:52708662-52708684 CATAGTCCCGAGGCCGAGGCGGG - Intergenic
1190671889 X:52749746-52749768 CATAGTCCCGAGGCCGAGGCGGG + Intergenic
1198158508 X:133985350-133985372 TGGCGTCCGGCGGCGGCGGCGGG + Exonic
1199644510 X:149893284-149893306 CAGATTCAGGAGGCTGAGGCAGG + Intergenic
1200292601 X:154886786-154886808 CAGAGGGCGGCGGCGGCGGCCGG - Exonic
1200292620 X:154886846-154886868 AAGTGACCGGCGGCGGCGGCCGG - Exonic
1200339445 X:155382526-155382548 CAGAGGGCGGCGGCGGCGGCCGG - Exonic
1200339464 X:155382586-155382608 AAGTGACCGGCGGCGGCGGCCGG - Exonic
1200347006 X:155458107-155458129 AAGTGACCGGCGGCGGCGGCCGG + Exonic
1200347025 X:155458167-155458189 CAGAGGGCGGCGGCGGCGGCCGG + Exonic