ID: 981617359

View in Genome Browser
Species Human (GRCh38)
Location 4:146655457-146655479
Sequence GGCCGCGGCGGAGCGGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981617359_981617376 27 Left 981617359 4:146655457-146655479 CCGCCGGCCGCTCCGCCGCGGCC No data
Right 981617376 4:146655507-146655529 CGCGGTCTGCCCCGGAGCCCCGG No data
981617359_981617377 30 Left 981617359 4:146655457-146655479 CCGCCGGCCGCTCCGCCGCGGCC No data
Right 981617377 4:146655510-146655532 GGTCTGCCCCGGAGCCCCGGAGG No data
981617359_981617370 9 Left 981617359 4:146655457-146655479 CCGCCGGCCGCTCCGCCGCGGCC No data
Right 981617370 4:146655489-146655511 GGAAGCGTCCCAAGCCCGCGCGG No data
981617359_981617373 19 Left 981617359 4:146655457-146655479 CCGCCGGCCGCTCCGCCGCGGCC No data
Right 981617373 4:146655499-146655521 CAAGCCCGCGCGGTCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981617359 Original CRISPR GGCCGCGGCGGAGCGGCCGG CGG (reversed) Intergenic
No off target data available for this crispr