ID: 981624316

View in Genome Browser
Species Human (GRCh38)
Location 4:146738584-146738606
Sequence GAGTTATGAACCGGGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 2, 2: 40, 3: 92, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981624316_981624324 22 Left 981624316 4:146738584-146738606 CCACAGTTCCCGGTTCATAACTC 0: 1
1: 2
2: 40
3: 92
4: 209
Right 981624324 4:146738629-146738651 TGTCATAATGTTGGAGTGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 149
981624316_981624323 13 Left 981624316 4:146738584-146738606 CCACAGTTCCCGGTTCATAACTC 0: 1
1: 2
2: 40
3: 92
4: 209
Right 981624323 4:146738620-146738642 ACAGTCTTTTGTCATAATGTTGG 0: 2
1: 39
2: 88
3: 140
4: 228
981624316_981624325 29 Left 981624316 4:146738584-146738606 CCACAGTTCCCGGTTCATAACTC 0: 1
1: 2
2: 40
3: 92
4: 209
Right 981624325 4:146738636-146738658 ATGTTGGAGTGTTAGGTCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 107
981624316_981624326 30 Left 981624316 4:146738584-146738606 CCACAGTTCCCGGTTCATAACTC 0: 1
1: 2
2: 40
3: 92
4: 209
Right 981624326 4:146738637-146738659 TGTTGGAGTGTTAGGTCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981624316 Original CRISPR GAGTTATGAACCGGGAACTG TGG (reversed) Intronic