ID: 981624638

View in Genome Browser
Species Human (GRCh38)
Location 4:146741801-146741823
Sequence AGTTGTGACGGGAGTAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981624638_981624642 -5 Left 981624638 4:146741801-146741823 CCTACTCTACTCCCGTCACAACT 0: 1
1: 0
2: 1
3: 6
4: 96
Right 981624642 4:146741819-146741841 CAACTTGAAAGCATTTCCATGGG No data
981624638_981624644 14 Left 981624638 4:146741801-146741823 CCTACTCTACTCCCGTCACAACT 0: 1
1: 0
2: 1
3: 6
4: 96
Right 981624644 4:146741838-146741860 TGGGAAGCTTCTCCTAAGTTAGG 0: 1
1: 0
2: 0
3: 13
4: 112
981624638_981624641 -6 Left 981624638 4:146741801-146741823 CCTACTCTACTCCCGTCACAACT 0: 1
1: 0
2: 1
3: 6
4: 96
Right 981624641 4:146741818-146741840 ACAACTTGAAAGCATTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981624638 Original CRISPR AGTTGTGACGGGAGTAGAGT AGG (reversed) Intronic
907630467 1:56076497-56076519 AGTTGTGATGAGAGAAGAGGTGG - Intergenic
907649600 1:56282404-56282426 AGTTGTGATGGCAGTAGAGGTGG - Intergenic
907772834 1:57483284-57483306 TGTTGTGAGGGGAGTCCAGTGGG + Intronic
909318068 1:74248278-74248300 AGGTGTGGAGGGAGTGGAGTGGG - Intronic
909754860 1:79212554-79212576 AATGGTGAAGGAAGTAGAGTAGG - Intergenic
911682779 1:100737132-100737154 AGTTGTAAATGGAGTACAGTAGG - Intronic
915626236 1:157115610-157115632 AGTTGAGGCGGCAGTTGAGTAGG - Intergenic
917068334 1:171122282-171122304 AGAAGTGAGGGGAGGAGAGTTGG + Intergenic
920664829 1:207955486-207955508 AGTTGTCACGGGAGTGGAAGAGG - Intergenic
921136192 1:212261324-212261346 AGTTCAGAAGGCAGTAGAGTAGG + Intergenic
921570824 1:216776299-216776321 ATGTGTGTTGGGAGTAGAGTGGG - Intronic
1063959705 10:11297160-11297182 AGTTGTGAGGGGAGTTGAGGAGG + Intronic
1070437396 10:76406613-76406635 GGCTGTCATGGGAGTAGAGTTGG + Intronic
1074420374 10:113303481-113303503 AGGTCAGACTGGAGTAGAGTGGG - Intergenic
1075095127 10:119466236-119466258 AGTGGTGGCGGGAGCAGAGCTGG - Intergenic
1075929822 10:126286334-126286356 AGTTGTGATGGGAGTGGACTTGG - Intronic
1076157118 10:128212574-128212596 AGGTCATACGGGAGTAGAGTGGG + Intergenic
1077428848 11:2504340-2504362 GGTTGTGAGGGAAGTAGAGATGG + Intronic
1077953490 11:6988334-6988356 ATTTGTGTCTGGATTAGAGTAGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088719207 11:112576971-112576993 AGTTGTATCTGGAGTAGAGGAGG + Intergenic
1094576073 12:31686947-31686969 AGTTGTGAAGGAACAAGAGTAGG - Intronic
1097161370 12:57048659-57048681 AGTTGTGACTGAAGGAGAGAGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103886636 12:124207377-124207399 AGTTGTGACAGGATTAGAACAGG - Intronic
1104823048 12:131689259-131689281 AGTTATGATGGGAGTGGATTAGG + Intergenic
1104997075 12:132664758-132664780 AGGTGTGAAGAGAGTAGAGAAGG - Intronic
1107458684 13:40579456-40579478 AGTTATGACAGGAGAAGAATGGG + Intronic
1110619555 13:77579731-77579753 CGTTGTATCTGGAGTAGAGTAGG + Intronic
1111182220 13:84684663-84684685 AGTAGAGGTGGGAGTAGAGTGGG + Intergenic
1111618134 13:90687879-90687901 AGGTGTAACGAGAGTAGAGTTGG + Intergenic
1119389524 14:74281554-74281576 AGTTGAGAAGGAAGCAGAGTGGG - Intergenic
1119857574 14:77912326-77912348 AGTAGTGTTGGGAGTAGATTAGG + Intronic
1121977309 14:98417166-98417188 AGTTGTGCGGAGAGTAGACTTGG - Intergenic
1122550297 14:102545580-102545602 AGTTTGGACGGGACTAGAGAGGG + Intergenic
1125121388 15:36162660-36162682 AATTGTGAAGTTAGTAGAGTTGG + Intergenic
1129982326 15:79884922-79884944 AGGTGTGATGGGAGTATAGCAGG - Intronic
1131612333 15:93978153-93978175 AGTGGGGATGGGAGTAGGGTAGG - Intergenic
1133056159 16:3146363-3146385 AGGTGTGAGGAGAGTGGAGTGGG - Intronic
1133534960 16:6693070-6693092 GGTTGTGATGGTAGTAGAGGAGG - Intronic
1136641750 16:31570514-31570536 AGTTGTGAGGGGTGAGGAGTGGG + Intergenic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1143886206 17:10066843-10066865 AGTGGTGAAGAGAGTAGACTTGG + Intronic
1146286251 17:31575903-31575925 AGTTGAGGCAGGAGTAGAGGAGG + Intergenic
1149696597 17:58621163-58621185 AGCTGTGATGGGAGAAGAGGGGG + Intronic
1150167985 17:62963268-62963290 AGTTGTGAGTGGGGTATAGTAGG - Intergenic
1160296860 18:77646521-77646543 TGTTGTGGCTGGAGTCGAGTGGG + Intergenic
1161637939 19:5400993-5401015 AGATGTAACTGGAGTAGGGTGGG + Intergenic
1166876150 19:45898739-45898761 AGTAGAGATGGGAATAGAGTAGG - Intronic
930231055 2:48844165-48844187 AGTAGTGACAGGAGAGGAGTCGG + Intergenic
931081979 2:58783838-58783860 AGTTGTGTCAGGCTTAGAGTAGG - Intergenic
931690876 2:64833993-64834015 AGCTGTGACAGGAGTTGGGTGGG + Intergenic
939835384 2:147124127-147124149 TGTGGTGGCGGGAGTAGAGAAGG + Intergenic
943555989 2:189404443-189404465 AGTTGGGAGTGGAGTAGAGGTGG - Intergenic
943833219 2:192487942-192487964 AGTTGTGGAGGGGGGAGAGTTGG - Intergenic
948309891 2:236977157-236977179 AGTTGTGACATCAGCAGAGTTGG - Intergenic
1173919063 20:46730433-46730455 GGTTGTGGCTGAAGTAGAGTGGG + Intronic
1174884295 20:54315172-54315194 AGTTGTGACAGAAGAAGTGTTGG + Intergenic
1181291533 22:21798169-21798191 AGTGCTGACGGTTGTAGAGTAGG - Intronic
1184008670 22:41730262-41730284 ATTAGTGGCGGAAGTAGAGTTGG - Intronic
1184381447 22:44147292-44147314 AGTTGTGGTGGGAGTGGAGGGGG + Intronic
949926846 3:9048377-9048399 AGCTGTGACTGGCTTAGAGTAGG + Intronic
964175251 3:153820203-153820225 GTTTGTGATGGGAGTGGAGTGGG - Intergenic
966552696 3:181222771-181222793 AGTTTTTACTGGAGTAAAGTGGG + Intergenic
966762015 3:183427586-183427608 GCTTCTGACGGGAGTAGGGTGGG - Intronic
969927213 4:10595921-10595943 AGGTGTGCTGGGAATAGAGTAGG - Intronic
972362956 4:38345750-38345772 AGTTGAGAAGGGAGCAGTGTGGG + Intergenic
973907392 4:55546124-55546146 AGTGGTGACAGGAATAAAGTGGG + Intronic
976359010 4:84155507-84155529 GGTTGTGACAGAAGTAGAGAAGG + Intergenic
978727347 4:111984694-111984716 TGTTGTGACGGGAGCACAGCTGG - Intergenic
981624638 4:146741801-146741823 AGTTGTGACGGGAGTAGAGTAGG - Intronic
986961054 5:13213350-13213372 AATTTTGACGGGAGCAGAGCAGG - Intergenic
991772589 5:70053586-70053608 AATTATGACAGGAGTAGTGTTGG + Intronic
991851882 5:70929010-70929032 AATTATGACAGGAGTAGTGTTGG + Intronic
992971370 5:82062257-82062279 AGTTGTCACGGGAATGGAATCGG + Intronic
995707495 5:115000254-115000276 AGATGGGAAGGGAGAAGAGTGGG + Intergenic
998757572 5:145397874-145397896 AGTTGTGGCGGGAATATATTAGG + Intergenic
1006445949 6:34079893-34079915 TGTTGTGCAGGGAATAGAGTGGG - Intronic
1007309389 6:40933488-40933510 AGGTGTGATTGGAGTAGAGGAGG - Intergenic
1008235111 6:49036844-49036866 AGTTATGACTGGAGTTGAGAAGG + Intergenic
1008883848 6:56410709-56410731 TGTTATGACTGGGGTAGAGTTGG - Intergenic
1010425463 6:75724396-75724418 AGCTGTGACAGGAGGAGAATGGG - Intergenic
1013854055 6:114550663-114550685 AGTTAAGACTGGAGTGGAGTGGG + Intergenic
1019828837 7:3305579-3305601 AGTTGTAAAGGGAGTAGGTTAGG - Intronic
1024527689 7:50362771-50362793 AGTTGTGACCGGATAAGAGCAGG + Intronic
1027888312 7:83937801-83937823 AGTTGGGAGGGGAATGGAGTGGG - Intergenic
1030943934 7:115692494-115692516 AGATGTGAGGGGAGTAGGGATGG + Intergenic
1033221361 7:139528250-139528272 AGGTCAGACTGGAGTAGAGTGGG + Intronic
1034131452 7:148722325-148722347 AGAAGTGAGGGGAGTGGAGTGGG - Intronic
1035650852 8:1263481-1263503 AGTTATGAAGGGAGAAGAGGTGG - Intergenic
1041358964 8:57030216-57030238 TGTTGTGAAGGGAGTAGGGAGGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1047419686 8:124696941-124696963 AGAAGTGATGGGGGTAGAGTAGG - Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1055369365 9:75580656-75580678 AGTTGTGACGGGAGTGTGGTTGG + Intergenic
1056170269 9:83979343-83979365 AGGTGTGGTGGGAGAAGAGTTGG + Intronic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1060865023 9:126988791-126988813 AGTTGTGTCTGGAGAAAAGTGGG + Intronic
1192537229 X:71938549-71938571 AGTGGTGAAGGGAGGCGAGTAGG + Intergenic
1195362688 X:104099752-104099774 AGTGGTGGGGGGAGAAGAGTAGG + Exonic
1196657580 X:118235129-118235151 AGGTGATACTGGAGTAGAGTGGG - Intergenic
1197860940 X:130969460-130969482 AGGTGTCAGGGGAGTGGAGTAGG + Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic
1199882039 X:151981600-151981622 AGATGAGATGGGAGTAGAGGAGG + Intergenic